Log In Sign up
The largest database of trusted experimental protocols

Quantstudio 6 flex real time pcr

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States, Japan

The QuantStudio™ 6 Flex Real-Time PCR System is a thermal cycler designed for real-time polymerase chain reaction (PCR) analysis. It is capable of performing quantitative PCR (qPCR) experiments to measure and analyze nucleic acid samples.

Automatically generated - may contain errors

Lab products found in correlation

High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (17 mentions) Trizol, by Thermo Fisher Scientific (13 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (8 mentions) Iscript cdna synthesis kit, by Bio-Rad (5 mentions) Rneasy plus mini kit, by Qiagen (5 mentions) Rneasy mini kit, by Qiagen (5 mentions) Quantstudio real time pcr software, by Thermo Fisher Scientific (4 mentions) Perfecta sybr green fastmix low rox, by Quanta Biosciences (3 mentions) Rlt buffer, by Qiagen (3 mentions) Taqman probe, by Thermo Fisher Scientific (3 mentions) Trizol reagent, by Thermo Fisher Scientific (3 mentions) Omniscript rt kit, by Qiagen (3 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (3 mentions) Taqman gene expression assay, by Thermo Fisher Scientific (3 mentions) Sybr premix ex taq, by Takara Bio (2 mentions) Goscript reverse transcription system, by Promega (2 mentions) Power sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Sybr green, by Thermo Fisher Scientific (2 mentions) Iq sybr green supermix, by Thermo Fisher Scientific (2 mentions) Low protein binding tube, by Eppendorf (2 mentions)

40 protocols using quantstudio 6 flex real time pcr

1

Ileal Epithelial and Lamina Propria Cell Isolation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Ileal epithelial cells and lamina propria mononuclear cells were isolated from ileal tissue as previously described and stored in RLT buffer (Qiagen). RNA was extracted and purified using RNeasy Plus Mini Kit (Qiagen) and quantified by Nanodrop prior to reverse transcription with iScript cDNA synthesis kit (Bio-Rad). qPCR was performed on an Applied BioSciences Quant Studio 6 Flex Real-time PCR (Applied Biosystems) using PerfeCTa SYBR Green Fast mix, Low ROX (Quanta Biosciences). The thermocycler program was as follows: initial cycle of 95°C for 60 s, followed by 40 PCR cycles at 95°C for 5 s, 60°C for 15 s, 72°C for 15 s. Relative levels of the target genes were determined by calculating the ΔCt to housekeeping gene hprt expression. Primer sequences can be found in Table S3.20 (link),69 (link)–72 (link)
Viladomiu M., Khounlotham M., Dogan B., Lima S.F., Elsaadi A., Cardakli E., Castellanos J.G., Ng C., Herzog J., Schoenborn A.A., Ellermann M., Liu B., Zhang S., Gulati A.S., Sartor R.B., Simpson K.W., Lipkin S.M, & Longman R.S. (2022). Agr2-associated ER stress promotes adherent-invasive E. coli dysbiosis and triggers CD103+ dendritic cell IL-23-dependent ileocolitis. Cell reports, 41(7), 111637.
+ Open protocol
+ Expand
2

Quantitative Real-Time PCR of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from islets and MIN6 cells using the RNAEasy Mini kit (Qiagen) according to the manufacturer’s protocol. Mouse organs were homogenized using Tissue Lyser II (Qiagen) before RNA extraction. DNA contaminants were eliminated using RNase-free DNase I (Qiagen). High Capacity cDNA kit (Invitrogen) was used to synthesize cDNA from 250ng to 1μg RNA, depending on the amount of available starting material. Quantitative real-time PCR was performed using Taqman Gene Expression Master mix (Applied Biosystems) according to the manufacturer’s instructions on QuantStudio™ 6 Flex Real-Time PCR (Applied Biosystems). Taqman probes (Thermo Fisher Scientific) were used for PCR quantification, as listed in S2 Table. The 2-ddct method was applied to analyze gene expression [17 (link)]. Hprt (hypoxanthine phosphoribosyltransferase) was used as references gene. Data are expressed as fold change versus control (NP and non-treated samples).
Sisino G., Zhou A.X., Dahr N., Sabirsh A., Soundarapandian M.M., Perera R., Larsson-Lekholm E., Magnone M.C., Althage M, & Tyrberg B. (2017). Long noncoding RNAs are dynamically regulated during β-cell mass expansion in mouse pregnancy and control β-cell proliferation in vitro. PLoS ONE, 12(8), e0182371.
+ Open protocol
+ Expand
3

Gene Expression Analysis Protocol

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Gene expression analysis was performed as previously described (Reddy et al., 2020 (link)). Total RNA from cells was isolated using TRIzol (Ambion #15596018) with Qiagen RNA Mini Kit (QIAGEN #12183025). RNA content was quantified using a Nanodrop 2000 UV-visible spectrophotometer. cDNA synthesis was performed via reverse-transcription polymerase chain reaction (RT-PCR) using 100 ng of RNA for ATP1A2 experiments (500–1000 ng of RNA for LETMD1 experiments) and a high-capacity cDNA reverse transcription kit (ThermoFisher Scientific #4368813). cDNA was then used for real-time quantitative PCR (qPCR) analysis, which was performed in 384-well plate using GoTaq qPCR Master Mix (Promega #A6001). QuantStudio 6 Flex Real-Time PCR instrument (Applied Bio-systems) was used to run samples. Relative abundance of ATP1A2 was calculated by the delta-delta Ct methods using cyclophilin for ATP1A2 experiments (RPLP0 for LETMD1 experiments) as endogenous control.
Sell D.R., Lane M.A., Johnson W.A., Masoro E.J., Mock O.B., Reiser K.M., Fogarty J.F., Cutler R.G., Ingram D.K., Roth G.S, & Monnier V.M. (1996). Longevity and the genetic determination of collagen glycoxidation kinetics in mammalian senescence.. Proceedings of the National Academy of Sciences of the United States of America, 93(1), 485-490.
+ Open protocol
+ Expand
4

RNA Extraction, cDNA Synthesis, and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted with NucleoSpin® RNA kit (Macherey-Nagel, Duren, Germany) and reverse transcribed with iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). qPCR reactions were performed with Fast SYBR™ Green Master Mix (Applied Biosystems, Waltham, MA, USA), using 7900HT Fast Real-Time PCR (Applied Biosystems, Waltham, MA, USA) and QuantStudio 6 Flex Real-Time PCR (Applied Biosystems, Waltham, MA, USA) platforms. ACTB, B2M and RNA18S1 were used as housekeeping genes, depending on the sample origin and the platform (primer sequences in Table S1).
Peris-Torres C., Plaza-Calonge M.D., López-Domínguez R., Domínguez-García S., Barrientos-Durán A., Carmona-Sáez P, & Rodríguez-Manzaneque J.C. (2020). Extracellular Protease ADAMTS1 Is Required at Early Stages of Human Uveal Melanoma Development by Inducing Stemness and Endothelial-Like Features on Tumor Cells. Cancers, 12(4), 801.
+ Open protocol
+ Expand
5

Vitellogenic Stage RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The RNAs, extracted from nervous tissues and ovary at three vitellogenic stages (n = 5 per stage), were used for cDNA synthesis. Quantitative real-time PCR (qRT-PCR) was performed by a QuantStudio™ 6 Flex Real-Time PCR (Applied Biosystems) with SYBR® Select Master Mix (TaKaRa, Shiga, Japan) according to the user manual. The internal control was performed using β-actin.
Lin D., Wei Y, & Ye H. (2020). Role of Oxytocin/Vasopressin-Like Peptide and Its Receptor in Vitellogenesis of Mud Crab. International Journal of Molecular Sciences, 21(7), 2297.
+ Open protocol
+ Expand
6

Gut transcriptome analysis in Drosophila

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated from n ≥ 14 guts per sample with TRIzol (Invitrogen, Thermo Fisher Scientific, Waltham, MA) and cDNA was synthesized by using SuperScript II Reverse Transcriptase (Invitrogen) according to manufacturers instructions. qPCR was carried out by using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific) on QuantStudio6 Flex real-time PCR (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA). The following primer sequences (Eurofins, UK) were used in the analysis: dsxF-F (TCAACACGTTCGCATCACAAA); dsxF-R (TAGACTGTGATTAGCCCAATAACTGA), act5C-F (CACACCAAATCTTACAAAATGTGTGA); act5C-R (AATCCGGCCTTGCACATG); dipericin-F (GCGGCGATGGTTTTGG); dipericin-R (CGCTGGTCCACACCTTCTG); Duox-F (TAGCAAGCCGGTGTCGCAATCAAT); Duox-R: ACGGCCAGAGCACTTGCACATAG.
Regan J.C., Khericha M., Dobson A.J., Bolukbasi E., Rattanavirotkul N, & Partridge L. (2016). Sex difference in pathology of the ageing gut mediates the greater response of female lifespan to dietary restriction. eLife, 5, e10956.
+ Open protocol
+ Expand
7

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was extracted from the brain, cells, and neurospheres by using the RNeasy kit (Qiagen) with in‐column DNase digestion formula and quantified using Nanodrop. cDNA was prepared from 200 ng of RNA in two steps using the GoScript reverse transcription system (Promega). The primers used for this study were published previously.32 All PCR reactions were performed in triplicate by the real‐time fluorescence detection method by using SYBR green DNA‐binding fluorescent dye (SYBR Premix Ex Taq; TaKaRa) on a QuantStudio 6 Flex real‐time PCR (Applied Biosystems) detection instrument. Relative expression was calculated using the threshold cycle (CT), and Gapdh (glyceraldehyde‐3‐phosphate dehydrogenase) was used as an internal control.
Soni N., Tripathi A., Mukherjee S., Gupta S., Mohanty S., Basu A, & Banerjee A. (2022). Bone marrow‐derived extracellular vesicles modulate the abundance of infiltrating immune cells in the brain and exert an antiviral effect against the Japanese encephalitis virus. FASEB BioAdvances, 4(12), 798-815.
+ Open protocol
+ Expand
8

DENV-1 Quantification in Mosquitoes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Dengue infection was detected through the quantification of DENV-1 using whole mosquitoes. RNA extraction was carried out using QIAamp Viral RNA Mini Kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer’s instructions, followed by RT-qPCR using the system QuantStudio 6 Flex Real-Time PCR (Applied Biosystems, Waltham, MA, USA) with primers and protocols described elsewhere [39 (link)]. Virus copy numbers were calculated by interpolation onto an internal standard curve made up of a seven-point dilution series (101–107 PFU/mL) of the same DENV virus offered to mosquitoes.
Petersen M.T., Couto-Lima D., Garcia G.A., Pavan M.G., David M.R, & Maciel-de-Freitas R. (2023). Dengue Exposure and Wolbachia wMel Strain Affects the Fertility of Quiescent Eggs of Aedes aegypti. Viruses, 15(4), 952.
+ Open protocol
+ Expand
9

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from treated and control cells was isolated by TRIzol™ as per the manufacturer’s instructions. cDNA was synthesized from total RNA with a high-capacity cDNA reverse transcription kit (ThermoFisher Scientific). Each qPCR reaction was carried out in a volume of 20 µL, consisting of 5 µL of cDNA sample (1:25 cDNA dilution) and 15 µL of SYBR Green I PCR master mix solution containing PCR buffer. The PCR was carried out by incubating the reaction mixture first for 10 min at 95 °C followed by 40 cycles of 15 s incubations at 95 °C and 1 min at 60 °C in a QuantStudio™ 6 Flex Real-Time PCR (Applied Biosystems). Data were analyzed using the ΔΔCT method and presented as arbitrary units that were normalized to the expression of housekeeping genes ACTIN or GAPDH.
Al Otaibi A., Al Shaikh Mubarak S., Al Hejji F., Almasaud A., Al Jami H., Iqbal J., Al Qarni A., Harbi N.K, & Bakillah A. (2024). Thapsigargin and Tunicamycin Block SARS-CoV-2 Entry into Host Cells via Differential Modulation of Unfolded Protein Response (UPR), AKT Signaling, and Apoptosis. Cells, 13(9), 769.
+ Open protocol
+ Expand
10

Ileal Epithelial and Lamina Propria Cell Isolation

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Ileal epithelial cells and lamina propria mononuclear cells were isolated from ileal tissue as previously described and stored in RLT buffer (Qiagen). RNA was extracted and purified using RNeasy Plus Mini Kit (Qiagen) and quantified by Nanodrop prior to reverse transcription with iScript cDNA synthesis kit (Bio-Rad). qPCR was performed on an Applied BioSciences Quant Studio 6 Flex Real-time PCR (Applied Biosystems) using PerfeCTa SYBR Green Fast mix, Low ROX (Quanta Biosciences). The thermocycler program was as follows: initial cycle of 95°C for 60 s, followed by 40 PCR cycles at 95°C for 5 s, 60°C for 15 s, 72°C for 15 s. Relative levels of the target genes were determined by calculating the ΔCt to housekeeping gene hprt expression. Primer sequences can be found in Table S3.20 (link),69 (link)–72 (link)
Viladomiu M., Khounlotham M., Dogan B., Lima S.F., Elsaadi A., Cardakli E., Castellanos J.G., Ng C., Herzog J., Schoenborn A.A., Ellermann M., Liu B., Zhang S., Gulati A.S., Sartor R.B., Simpson K.W., Lipkin S.M, & Longman R.S. (2022). Agr2-associated ER stress promotes adherent-invasive E. coli dysbiosis and triggers CD103+ dendritic cell IL-23-dependent ileocolitis. Cell reports, 41(7), 111637.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!