Tibialis muscles were immersed in liquid nitrogen and stored at −80°C. Transcripts encoding antioxidative enzymes (SOD1, SOD2, catalase) and proteins involved in mitochondrial function (PGC1α, ß, and NRF1) were analyzed. Two micrograms of RNA, isolated with TRIzol Reagent (Invitrogen), were converted to cDNA with SuperScript II reverse transcriptase (Invitrogen, Life Technologies) and hexamer primers according to the supplier's protocol. Quantitative RT-PCR was performed using the QuantiTectTM SYBR Green PCR kit (Roche) according to the supplier's protocol. Primers were for Sod1, 5′-CCAGTGCAGGACCTCATTTT-3′ (sense) and 5′-TTGTTTCTCATGGACCACCA-3′ (antisense); for Sod2, 5′-ACCCAAAGTCACGCTTGATAG-3′ (sense) and 5′-GGACAAACCTGAGCCCTAAG-3′ (antisense); for Catalase, 5′-CACTGACGAGATGGCACACT-3′ (sense) and 5′-TGTGGAGAATCGAACGGCAA-3′ (antisense); for Pgc-1α, 5′-AAGTGTGGAACTCTCTGGAACTG-3′ (sense) and 5′-GGGTTATCTTGGTTGGCTTTATG-3′ (antisense); for Pgc-1β, 5′-TGCGGAGACACAGATGAAGA-3′ (sense) and 5′-GGCTTGTATGGAGGTGTGGT-3′ (antisense); for Nrf-1, 5′-TGGAGTCCAAGATGCTAATG-3′ (sense) and 5′-AGAGCTCCATGCTACTGTTC-3′ (antisense).
Quantitect sybr green pcr kit
Manufactured by Roche
Sourced in Germany, Switzerland
The QuantiTect SYBR Green PCR kit is a reagent kit designed for quantitative real-time PCR (qPCR) analysis. It contains the necessary components, including a SYBR Green-based master mix, for the sensitive and reliable detection and quantification of target DNA sequences.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (7 mentions)
Quantitect reverse transcription kit, by Qiagen (5 mentions)
Lightcycler, by Roche (4 mentions)
Lightcycler 480, by Roche (3 mentions)
Rneasy mini kit, by Qiagen (3 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Reverse transcription kit, by Roche (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Omniscript reverse transcription kit, by Takara Bio (1 mentions)
Total rna kit, by Thermo Fisher Scientific (1 mentions)
Oligo dt primer, by Takara Bio (1 mentions)
Lightcycler 1.5 instrument, by Roche (1 mentions)
Applied biosystems 3500 genetic analyzer, by Thermo Fisher Scientific (1 mentions)
Hs rnu6 2 11 miscript primer assay, by Qiagen (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Nanodrop spectrophotometer, by Qiagen (1 mentions)
Lightcycler 1, by Roche (1 mentions)
Rlt solution, by Qiagen (1 mentions)
Maxima first strand cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
17 protocols using quantitect sybr green pcr kit
1
Quantifying Antioxidant and Mitochondrial Genes
2
RNA Isolation and Quantitative RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using TRIzol reagent (Invitrogen). cDNA was synthesized from 2 μg of RNA by reverse transcription using random primers and SuperScript II reverse transcriptase (Invitrogen, Life Technologies), according to the supplier's protocol. Quantitative RT-PCR analysis was performed with gene-specific primers using the QuantiTectTM SYBR Green PCR kit (Roche), according to supplier's protocol. Relative abundance of transcript levels was calculated after normalization to hypoxanthine-guanine phosphoribosyltransferase (Hprt). The primer sequences are given in Supplementary Table 1 .
3
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the tissue using the reagent box of Total RNA Kit (Invitrogen, Carlsbad, CA, US), according to the manufacturer's instructions. The concentration of RNA was measured by using a spectrophotometer and the purity was ascertained by the A 260/A 280 ratio with a Nanodrop® 8000. Total RNA from each sample was reverse transcribed to cDNA with an Omniscript® Reverse Transcription kit (Takara) with Oligo-dT primers (Takara) according to the manufacturer's instructions and used for RT-PCR. The target fragments were quantified by real-time PCR using a QuantiTectTMSYBR Green® PCR Kit (Roche) with 100 ng of the cDNA template. Each sample was tested in duplicate. The gene expression data were normalized to β-actin expression. The primers used correspond to the rat sequences shown in Table 1 ; primer design was done using Amplify software (TaKaRa, Nanjing, China). For each real-time PCR assay, the threshold cycle Ct was determined for each reaction. Ct values for each gene of interest were normalized to the housekeeping gene (β-action); PCR amplification efficiencies were taken into account by amplifying various amounts of target cDNA for each reaction. The fold differences in mRNA expression of samples were relative to the internal control sample, which was included in all runs.
4
Quantifying MCM5 mRNA Expression in OSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extracted from tissues samples were reverse transcribed into cDNA using a GoScript Reverse Transcription System kit (Monad; http://www.monadbiotech.com/ ) according to the manufacturer's instructions. Relative mRNA expressions were quantified by qPCR using the QuantiTect SYBR Green PCR kit (Roche Diagnostics) and normalized to GAPDH using primers listed in Table I . The cycling parameters were 40 cycles of 95°C for 15 sec, 60°C for 15 sec and 72°C for 30 sec. Relative mRNA levels were assessed by the comparative 2−ΔΔCq method (18 (link)). All analyses of the samples were conducted in triplicate.
For association of MCM5 expression levels with clinicopathologic features of OSCC, the relative expression levels of MCM5 were evaluated using qPCR as aforementioned. Relative mRNA levels of paired samples (adjacent vs. cancer tissues) were assessed by the comparative 2−ΔΔCq method. A ratio >1 was considered to have high MCM5 expression, whereas a ratio ≤1 was considered to have low MCM5 expression.
For association of MCM5 expression levels with clinicopathologic features of OSCC, the relative expression levels of MCM5 were evaluated using qPCR as aforementioned. Relative mRNA levels of paired samples (adjacent vs. cancer tissues) were assessed by the comparative 2−ΔΔCq method. A ratio >1 was considered to have high MCM5 expression, whereas a ratio ≤1 was considered to have low MCM5 expression.
5
Screening and Sequencing of PsuPV1 Viruses
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA isolates were initially screened with the PsuPV1 type-specific qPCR primer set (APV12-L1-RT-F: 5′-GATCCCAAGCAGACTCAAATG-3′ and APV12-L1-RT-R: 5′-ACCTGCATTAATTTGGTTACAAGG-3′), targeting the 100 bp fragment of the PsuPV1 L1 gene. The PsuPV1 qPCR test was performed using a QuantiTect SYBR Green PCR kit on a LightCycler 1.5 Instrument (Roche Diagnostics, Mannheim, Germany). Samples were considered PsuPV1-positive when showing specific melting peaks at around 77.5 °C. Furthermore, PsuPV1-negative samples were subjected to a highly sensitive broad-range Pi-PV PCR assay that allows the amplification of a 330 bp L1 gene fragment of all currently recognized Pi-PVs.
All Pi-PV PCR products were analyzed using 2% agarose gel electrophoresis. In addition, 16 randomly selected PsuPV1 qPCR and all five Pi-PV PCR–positive products were Sanger sequenced on an Applied Biosystems 3500 Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) automated sequencing instrument and analyzed using the BLAST algorithm [33 (link)]. All analyses were carried out in line with our previously published protocols [31 (link)].
All Pi-PV PCR products were analyzed using 2% agarose gel electrophoresis. In addition, 16 randomly selected PsuPV1 qPCR and all five Pi-PV PCR–positive products were Sanger sequenced on an Applied Biosystems 3500 Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) automated sequencing instrument and analyzed using the BLAST algorithm [33 (link)]. All analyses were carried out in line with our previously published protocols [31 (link)].
6
Quantification of miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from 70 to 90% confluent cells using QIAzol Lysis Reagent (Cat. #: 79306, QIAGEN, Hilden, Germany) according to the manufacturer’s recommendations. Subsequently, 1 μg of total RNA was reversely transcribed with the miScript II RT Kit (Cat. #: 218161, QIAGEN, Hilden, Germany) using the miScript HiFlex buffer to enable quantification of both miRNA and mRNA. qPCR was performed on the LightCycler 480 (Roche, Basel, Switzerland) using the QuantiTect SYBR Green PCR Kit (Cat. #: 204145, QIAGEN, Hilden, Germany). For the quantification of miR-200c-3p, the Hs_miR-200c_1 miScript Primer Assay (Cat. #: MS00003752, QIAGEN, Hilden, Germany) and Hs_RNU6-2_11 miScript Primer Assay (Cat. #: MS00033740, QIAGEN, Hilden, Germany) were used, with RNU6-2 serving as a reference gene. For mRNA quantification, expression levels of Keratin 8 (KRT8), E-cadherin (CDH1), N-cadherin (CDH2), Collagen Type III Alpha 1 Chain (COL3A1), Vimentin (VIM), zinc finger E-box binding homeobox 1 (ZEB1), zinc finger E-box binding homeobox 2 (ZEB2), and genes that have previously been associated with cisplatin resistance (see Table S1 ) were normalized to the mean expression of GAPDH and U6. Primer sequences are listed in Table S2 . Differences in gene expression were evaluated by the ΔΔCt method.
7
Quantitative RT-PCR Analysis of BRCA Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from BRCA cell lines using the TRIzol reagent (Thermo Fisher Scientific, Inc.) and was transcribed to cDNA using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). Reverse transcription was conducted at 37°C for 1 h, followed by 85°C for 5 sec according to the manufacturer's protocol. RT-qPCR was performed using the QuantiTect SYBR-Green PCR kit (Roche Diagnostics) as previously described (30 (link)). The primer sequences are listed in Table SI . The 2−ΔΔCq method was used to calculate the relative expression levels of the target genes (31 (link)). GAPDH was used for normalization. The reaction conditions were as follows: 95°C for 10 min, followed by 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec (39 cycles), and finally 72°C for 10 min.
8
Liver RNA Extraction and PTEN Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from each liver using TRIzol (Invitrogen, Carlsbad, CA, USA), as per the manufacturer's instructions. Purified RNA plus random hexamers were used in the Transcriptor First Strand cDNA synthesis kit (Roche, Indianapolis, IN, USA) in order to synthesize cDNA. All cDNA was stored at −80°C prior to polymerase chain reaction (PCR). PCR was performed using the Quantitect SYBR Green PCR kit in a LightCycler (Roche). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. Primer sequences were as follows: For PTEN: Forward: 5’ AACTTGCAATTCCCCAGTTTG-TG3’, reverse: 5’CCTTGTCA TTATCCGCACGC3’; for GAPDH: forward: 5’ACCACAGTCCATGCCATCAC3 ‘; reverse: 5’TCCACCACCACCCTGTTGCTGTA3’.
9
Quantitative RT-PCR Analysis of Macrophage RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA samples from macrophages were collected using RLT solution (Qiagen) with β-mercaptoethanol (β-ME; 1 : 100 dilution). Total RNA was extracted using RNeasy Mini kit (Qiagen) according to the manufacturer's instructions. RNA was quantified using a Nanodrop Spectrophotometer and cDNA generated using a QuantiTect Reverse Transcription Kit (100–200 ng RNA per reaction Qiagen). Real-time quantitative PCR was performed in a Roche Light Cycler 1.5 to quantify the steady-state concentration of RNA using a QuantiTect SYBR Green PCR Kit and primers as detailed in Table 2 . The reaction contained 3.6–7.3 ng RNA and 0.5 μM primers. Denaturation for 15 min at 95°C was followed by 60 cycles of denaturation (15 seconds at 95°C), annealing for 20 seconds, and extension for 25 seconds at 72°C. Copy numbers of mRNA were calculated using standard curves constructed using the respective PCR products eluted from agarose gels. All fragments were sequenced to confirm identity (Cogenics, Takeley, UK). Primers used and their annealing temperatures are in Table 2 .
10
Extraction and Quantification of IL-2 mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells by using Trizol reagent (Invitrogen, USA) according to the manufacturer's protocol. And cDNA was reverse transcribed from 3.0 μg of total RNA with random hexamer primers using a Maxima® First Strand cDNA Synthesis Kit (Fermentas, USA). qRT-PCR was performed on the LightCycler® 480IIreal-time PCR system (Roche, USA) using the QuantiTect SYBR Green PCR kit (Roche, USA). The 20 μl reaction mix contained 200 nM of each primer, 100 μl of LightCycler 480 SYBR green I master mix (Roche), and 1 μl of template cDNA. The primers for the IL-2 gene were F (5′- CAG GAT GGA GAA TTA CAG GAA CCT-3′) and R (5′-TTT CAA TTC TGT GGC CTG CTT-3′), and those used for β-actin gene were F (5′- TTG TTA CAG GAA GTC CCT TGC C-3′) and R (5′-ATG CTA TCA CCT CCC CTG TGT G-3′). For gene IL-2 and β-actin, the amplifications consisted of 10 min at 95°C followed by 40 cycles, each consisting of denaturing for 15 s at 95°C, annealing for 1 min at 60°C, and elongation for 30 s at 60°C. All PCR were performed in triplicate using cDNA synthesized from the same batch and starting amount of total RNA. The expression of IL-2 gene was determined using the comparative Ct method (2−ΔCt) after normalization to β-actin.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!