Input DNA and ChIP DNA (10 and 20 ng) were spotted on N+ Hybond membrane from Amersham Biosciences prewetted with 2× SSC (saline-sodium citrate) buffer and UV-cross-linked. The membranes were then blocked for 1 h at 37 °C using Rapid-Hyb buffer from Amersham Biosciences. Telomeric probes ((TTAGGG)4) or PCR-purified ALU probes were radiolabeled and hybridized to spotted DNA on the membranes at 37 °C overnight. The probes were washed off using successive 10-min washes of 2× SSC buffer, 2× SSC buffer with 0.1% SDS, and 0.2× SSC buffer. The membranes were then exposed to an imaging plate (Phosphor) and imaged using a Bio-Rad PhosphorImager.
Rapid hyb buffer
Manufactured by Cytiva
Sourced in Denmark
Rapid-Hyb buffer is a solution used in molecular biology and biotechnology applications. It is designed to facilitate rapid and efficient nucleic acid hybridization. The buffer is formulated to provide optimal conditions for the hybridization of DNA or RNA probes to target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Hybond, by Cytiva (14 mentions)
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Hybond n membrane, by Cytiva (4 mentions)
Hybond n membrane, by GE Healthcare (2 mentions)
Typhoon fla 7000 scanner, by GE Healthcare (2 mentions)
Hybond xl nylon membrane, by GE Healthcare (2 mentions)
Biometra eco maxi system, by Analytik Jena (2 mentions)
Hybond n, by Cytiva (2 mentions)
Phosphorimager, by Bio-Rad (1 mentions)
Phosphorimager, by GE Healthcare (1 mentions)
Megaprime kit, by Cytiva (1 mentions)
Hybond xl membrane, by Cytiva (1 mentions)
Image analyzer fla7000, by Fujifilm (1 mentions)
Hybond n nylon membrane, by Cytiva (1 mentions)
Megaprime dna labelling kit, by Cytiva (1 mentions)
Random priming kit, by Agilent Technologies (1 mentions)
Turbo dna free, by Thermo Fisher Scientific (1 mentions)
Totally rna isolation kit, by Thermo Fisher Scientific (1 mentions)
Rna sample loading buffer, by Merck Group (1 mentions)
Nanodrop one, by Thermo Fisher Scientific (1 mentions)
20 protocols using rapid hyb buffer
1
Telomeric and ALU Probe Hybridization
2
Visualizing Rhizobium Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rhizobium plasmids were visualized by the Eckhardt procedure [12 (link)]. Gels were transferred onto Hybond N+ membranes (Amersham) using the manufacturer’s protocol and cross-linked using a UV cross linker unit (Stratagene). Hybridizations were performed overnight using α32P-dCTP-labelled probes (Megaprime kit; Amersham) under high-stringency conditions (65 °C in rapid-Hyb buffer, Amersham). Hybridization signals were detected with a PhosphorImager (Molecular Dynamics).
3
Northern Blot Analysis of sRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were grown overnight in LB broth with 100 μg/mL ampicillin, where necessary. Overnight cultures were diluted 1:100 in fresh medium, and growth continued to the exponential phase (OD600 ≈ 0.6). IPTG (1 mM) was added to cultures for sRNA overexpression. After 20 min, cultures were directly extracted using the acidic hot phenol method, as described previously70 (link).
Northern blot analysis was performed as follows: 10 μg total RNAs were fractionated on a 5% polyacrylamide gel containing 7 M urea, and electrotransferred onto a HybondTM-XL membrane (Amersham Biosciences) via TE70 ECL Semi-dry transfer unit (Amersham Biosciences) at 185 mA for 1 h. Membranes were hybridized with 5′-32P labeled oligonucleotide probes in Rapid-Hyb buffer (Amersham Biosciences) at 42 °C, according to the manufacturer’s instructions. In most cases, the probe rnpBXb1 was used for detection of overexpressed sRNA from library plasmids. In cases where sRNA was not detected with rnpBXb1, specific oligonucleotide probes were used (listed inSupplementary Table 3 ). Hybridization signals were assessed using Image Analyzer FLA7000 (Fuji).
Northern blot analysis was performed as follows: 10 μg total RNAs were fractionated on a 5% polyacrylamide gel containing 7 M urea, and electrotransferred onto a HybondTM-XL membrane (Amersham Biosciences) via TE70 ECL Semi-dry transfer unit (Amersham Biosciences) at 185 mA for 1 h. Membranes were hybridized with 5′-32P labeled oligonucleotide probes in Rapid-Hyb buffer (Amersham Biosciences) at 42 °C, according to the manufacturer’s instructions. In most cases, the probe rnpBXb1 was used for detection of overexpressed sRNA from library plasmids. In cases where sRNA was not detected with rnpBXb1, specific oligonucleotide probes were used (listed in
4
Northern Blot Analysis of IRAIN in Breast Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from breast cancer samples was separated by electrophoresis on a 1.5% (w/v) denaturing agarose gel, transferred to a Hybond-N nylon membrane (Amersham, UK) and cross-linked with UV light. The probe was prepared from the IRAIN clone DNA with 32P-dCTP labeling using Megaprime DNA Labelling Kit (Amersham, UK). The membrane was prehybridized in Rapid-hyb buffer (Amersham) for 30 min, followed by hybridization with the labeled probe at 65°C for 2 h. The membrane was exposed to X-ray film overnight and the image was scanned by a densitometer.
5
Northern Blot Analysis of Mitochondrial Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated from heart tissue either by using the ToTALLY RNA isolation kit (Ambion) or by using TRIzol Reagent (Invitrogen), and subjected to DNase treatment (TURBO DNA-free, Ambion). 1–2 μg of total RNA was denatured in RNA Sample Loading buffer (Sigma), electrophoresed in 1 or 1.8% formaldehyde-MOPS agarose gels prior transfer onto Hybond-N+ membranes (GE Healthcare). After UV crosslinking the membranes were successively hybridized with various probes at 65°C in RapidHyb buffer (Amersham) and then washed in 2x SSC/0.1% SDS and 0.2x SSC/0.1% SDS before exposure. Mitochondrial probes used for visualization of mRNA and rRNA levels were restriction fragments labeled with α-32P-dCTP and a random priming kit (Agilent). Different tRNAs and 7S rRNA were detected using specific oligonucleotides labeled with γ-32P-dATP. Radioactive signals were detected by autoradiography.
6
Northern Blotting for RNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Northern blotting was performed according to a previously published protocol (Miyakoshi et al., 2019 (link)). Briefly, total RNA was isolated using the TRIzol reagent (Invitrogen), treated with TURBO DNase (Invitrogen), and precipitated with cold ethanol. RNA was quantified using NanoDrop One (Invitrogen). Total RNA (5 µg) was separated by gel electrophoresis on 6% polyacrylamide/7 M urea gels in 1 × TBE buffer for 3 hr at 250 V using Biometra Eco‐Maxi system (Analytik‐Jena). DynaMarker RNA Low II ssRNA fragments (BioDynamics Laboratory) were used as a size marker. RNA was transferred from the gel onto Hybond‐XL nylon membrane (GE Healthcare) by electroblotting for 1 hr at 50 V using the same system. The membrane was crosslinked with transferred RNA by 120 mJ/cm2 UV light, incubated for prehybridization in Rapid‐Hyb buffer (Amersham) at 42℃ for 1 hr, and then incubated for hybridization with a [32P]‐labeled probe JVO‐0749 and JVO‐0322 at 42℃ overnight to detect GcvB and 5S rRNA, respectively. The membrane was washed in three 15‐min steps in 5× SSC/0.1% SDS, 1× SSC/0.1% SDS, and 0.5× SSC/0.1% SDS buffers at 42℃. Signals were visualized on Typhoon FLA7000 scanner (GE Healthcare) and quantified using Image Quant TL software (GE Healthcare).
7
Genotyping of Neomycin Resistance Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genome DNA of the tail snips or ES cells was digested with EcoRІ. The probe used in Southern blot analysis for the Neor gene was generated by PCR with primers (5′-CCGGTGCCCTGAATGAACTGCAGG-3′ and 5′-CCAACGCTATGTCCTGATAGCGGT-3′ ). Southern blot hybridization was performed at 68°C in Rapid-Hyb Buffer (Amersham) with the 32P-labeled probes, followed by washing at room temperature and then at 68°C. Autoradiography was performed with FLA-7000 (Fuji Film).
8
Quantifying microRNA Expression in Cardiac Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cardiac tissue samples by using Trizol reagent (Gibco/BRL). Northern blots (van Rooij et al, 2008 (link)) to detect microRNAs were performed as described previously described. A U6 probe served as a loading control (IDT). 10 ug of total RNA from the indicated tissues was loaded on 20% acrylamide denaturing gels and transferred to Zeta-probe GT genomic blotting membranes (Bio-Rad) by electrophoresis. After transfer, the blots were cross-linked and baked at 80°C for 1 h. To maximize the sensitivity of miRNA detection, oligonucleotide probes were labeled with the Starfire Oligos Kit (IDT, Coralville, IA) and α-32P dATP (Amersham or Perkin Elmer). Probes were hybridized to the membranes overnight at 39°C in Rapid-hyb buffer (Amersham), after which they were washed twice for 10 min at 39°C with 0.5× SSC containing 0.1% SDS. The blots were exposed and quantified by PhosphorImager analysis (GE HealthCare Life Sciences) and a U6 probe served as a loading control (ABI). The intensity of the radioactive signal was used to quantify the fold change in expression using a phosphorimager and ImageQuant (Bio-Rad).
9
Northern Blot Analysis of Small RNAs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2 µg of total RNA in RNA loading dye (NEB) was separated by gel electrophoresis on 6% polyacrylamide/7 M urea gels in 1xTBE buffer for 3 h at 250 V and was electroblotted onto Hybond-XL nylon membrane (GE Healthcare) for 1 h at 50 V using Biometra Eco-Maxi system (Analytik-Jena). The membrane was crosslinked by 120 mJ/cm2 UV light. Oligonucleotides JVO-2624 and JVO-0485 to detect HPnc4160 and 5 S rRNA, respectively9 (link), were 5′-end-labeled with [32P]-γ-ATP by T4 polynucleotide kinase (Nippon Gene) and purified over G25 columns (GE Healthcare). After prehybridization in Rapid-Hyb buffer (Amersham), the [32P]-labeled probe was hybridized at 42 °C overnight. Membrane was washed in three steps in 5x SSC/0.1% SDS, 1x SSC/0.1% SDS and 0.5x SSC/0.1% SDS buffers for 15 min at 42 °C. Signals were visualized on Typhoon FLA7000 scanner (GE Healthcare).
10
Quantifying Telomere and Repeat Sequences
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For dot blot analysis, ChIP DNA was denatured at 95°C and dot blotted on hybond membrane (Amersham) in 2X SSC buffer. Membranes were pre-hybridized in Rapid-Hyb buffer (Amersham) for 15 min. Following this, hybridization with a DIG-labelled telomeric probe (CCCTAA)3, DIG-labeled Alu probe (5'—GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCA -3') and DIG-labeled α-satellite repeat sequences probe (5’-AGAGTGTTTCAAAACTGCTCTATCA AAAGGAATGTTCAACGCGTGATC-3’) was performed for 3 hours at 42°C and membranes washed with 2X SSC and 0.1% SDS three times before exposing overnight on phosphoimager imaging plate. All data were scanned using FUJI Phosphoimager FLA2000. Data was processed and quantified using Multi Gauge image analysis software.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!