Restriction enzymes, Klenow polymerase, T4 ligase and Pfu polymerase were purchased from Thermo Fischer Scientific. DNA oligonucleotides were acquired from Microsynth AG [42 ] or Sigma-Aldrich Co. All DNA constructs made were verified by sequencing by Microsynth AG. Plasmids were purified with GenElute HP Plasmid Miniprep kit (Sigma-Aldrich). Q5 polymerase was from New England BioLabs Inc. Dulbecco’s modified Eagle’s Medium, foetal bovine serum, Turbofect, penicillin and streptomycin were acquired from Thermo Fisher Scientific. The following plasmids were acquired from Addgene: piRFP670-N1 #45457 [32 (link)]; pX330-U6-Chimeric_BB-CBh-hSpCas9 #42230 [4 (link)]; pCAG-EGxxFP #50716 [31 (link)]; pY010 (pcDNA3.1-hAsCpf1) #69982 [24 (link)]; pY016 (pcDNA3.1-hLbCpf1) #69988 [24 (link)]; M-ST1cas #48669 [23 (link)]; and pSimpleII-U6-tracr-U6-BsmBI-NLS-NmCas9-HA-NLS(s) #47868, [35 (link)].
Klenow polymerase
Manufactured by Thermo Fisher Scientific
Sourced in United States
Klenow polymerase is a DNA polymerase enzyme derived from the Escherichia coli DNA polymerase I. It is capable of catalyzing the synthesis of DNA in a template-directed manner.
Automatically generated - may contain errors
Lab products found in correlation
Penicillin, by Thermo Fisher Scientific (4 mentions)
Streptomycin, by Thermo Fisher Scientific (4 mentions)
Turbofect, by Thermo Fisher Scientific (4 mentions)
Foetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
T4 ligase, by Thermo Fisher Scientific (2 mentions)
Dulbecco s modified eagle s medium, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Glutamax, by Thermo Fisher Scientific (2 mentions)
T4 dna ligase, by Thermo Fisher Scientific (2 mentions)
Superscript 2, by Thermo Fisher Scientific (2 mentions)
Pfu polymerase, by Thermo Fisher Scientific (1 mentions)
Genelute hp plasmid miniprep kit, by Merck Group (1 mentions)
Pirfp670 n1, by Addgene (1 mentions)
Px330 u6 chimeric bb cbh hspcas9, by Addgene (1 mentions)
Pcag egxxfp, by Addgene (1 mentions)
Py010, by Addgene (1 mentions)
Py016, by Addgene (1 mentions)
Q5 polymerase, by New England Biolabs (1 mentions)
Dna oligonucleotides, by Microsynth (1 mentions)
T4 pnk, by Thermo Fisher Scientific (1 mentions)
7 protocols using klenow polymerase
1
Plasmid Construct Verification
2
Cloning and Frameshift of PEX14(NTD)
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA-fragment encoding the PEX14(NTD) was cloned as XhoI/BamHI-fragment into Cerulean-N1 digested with the same enzymes. Subsequently, the reading frame was shifted by first digesting the plasmid with BamHI, the 5´-overhang ends were filled up Klenow-polymerase (Thermo) and the fragment was religated.
3
DNA Shearing, Enrichment, and Library Prep
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was sheared using a Diagenode Bioruptor set to “low” for 60 cycles of 30 sec on/30 sec off. After shearing, the DNA was filled in with Klenow polymerase and T4 PNK (no. EK0032, Thermo Scientific) for 30 min at 20°C. Following the fill-in reaction, DNA was pulled down on C1 beads that had been prepared by washing twice with Tween wash buffer before being resuspended in 200 μL 2× NTB (2 M NaCl, 10 mM Tris at pH 8.0, 0.1 mM EDTA at pH 8.0, 0.2% Triton X-100). Once the sample was added, the beads were incubated for 20 min at RT with rocking. Subsequently, unbiotinylated DNA fragments were removed by washing the beads three times before resuspending in low TE. Sequencing libraries were generated using established protocols (Meyer and Kircher 2010 (link)).
4
Genome Engineering with CRISPR-Cas9
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All restriction enzymes, Klenow polymerase and T4 ligase were acquired from Thermo Scientific, Q5 and Phusion polymerases T7 endonuclease I, and Gibson Assembly Master Mix were from New England Biolabs Inc. Oligonucleotides were purchased from Microsynth AG and Sigma-Aldrich Co. and their sequences are listed in the Supplementary Data . Dulbecco’s modified Eagle’s Medium, foetal bovine serum, Turbofect, Lipofectamine 2000, GlutaMAX, penicillin, streptomycin and puromycin were acquired from Thermo Fisher Scientific, and trimethoprim (TMP) from Sigma-Aldrich Co. (T7883).
5
TOP-seq Library Preparation from 5hmC-Labeled DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was sonicated to yield approximately 200–250 bp fragments with a Covaris M220 instrument and purified using a DNA Clean and Concentrator kit (Zymo Research). 5fC reduction to 5hmC, 5hmC protection and azide-labelling of 5hmC (5.8 µg of DNA in this step) were performed as described above for the hMe-Seal and fC-Seal libraries. Then, DNA was end-filled for 15 min at 20°C using a DNA End Repair Kit (Thermo Scientific) according to the vendor's recommendations and purified using a GeneJet Purification Kit (Thermo Scientific). DNA was then dA-tailed using 30 U of Klenow polymerase (Thermo Scientific) in 120 μl of its buffer (Thermo Scientific) in the presence of 0.5 mM dATP at 37°C for 45 min, enzyme inactivated at 75°C for 15 min followed by purification through GeneJet (Thermo Scientific) columns. Partially complementary annealed adaptors A1/A2 (2.25 μM, A1 5′ P-GATTGGAAGAGTGGTTCAGCAGGAATGCTGAG and A2 5′ ACACTCTTTCCCTACATGACACTCTTCCAATCT) were ligated to DNA using 30 U of T4 DNA ligase (Thermo Scientific) in 120 µl of its buffer (Thermo Scientific) at 22°C overnight, followed by thermal inactivation at 65°C for 10 min and column purification (DNA Clean and Concentrator; Zymo Research).
TOP-seq library enrichment and preparation were then done as in [15 (link)] and libraries were subjected to Ion Proton (Thermo Scientific) sequencing.
TOP-seq library enrichment and preparation were then done as in [15 (link)] and libraries were subjected to Ion Proton (Thermo Scientific) sequencing.
6
Viral Metagenomics from Fecal Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were deep sequenced using the Viseq method (Cotten et al. 2014 (link)). Briefly, 150 μl of faecal suspension was centrifuged for 10 min at 10,000 × g, and a DNase treatment (20 U TURBO DNase, Ambion) was performed on the supernatant. Nucleic acids were extracted using the Boom method (Boom et al. 1990) (link), followed by reverse transcription with Superscript II (Invitrogen) and Endoh primers (Endoh et al. 2005 (link)). Second strand synthesis was performed using Klenow polymerase (5U, Invitrogen) followed by phenol/chloroform/isoamylalcohol extraction and ethanol precipitation.
Illumina sequencing was performed by the standard methods for the paired-end Illumina MiSeq library preparation. Each sample was sheared and fractionated to an average length of 400–500 bp after which adaptors with sample-specific barcodes were ligated. Samples were polymerase chain reaction (PCR) amplified and sequenced with an Illumina MiSeq instrument (Cotten et al. 2014 (link)) to generate 149 nt paired end reads.
Illumina sequencing was performed by the standard methods for the paired-end Illumina MiSeq library preparation. Each sample was sheared and fractionated to an average length of 400–500 bp after which adaptors with sample-specific barcodes were ligated. Samples were polymerase chain reaction (PCR) amplified and sequenced with an Illumina MiSeq instrument (Cotten et al. 2014 (link)) to generate 149 nt paired end reads.
7
RNA Sequencing Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA was purified using Dynal Oilgo (dT) beads (Invitrogen) and then fragmented into 350 bp fragments using RNA Fragmentation Reagents (Ambion, Austin, TX, USA), followed by cDNA synthesis using random primers (Invitrogen), Superscript II (Invitrogen), RNase H and DNA polymerase I, and further end-repair with Klenow polymerase, T4 DNA polymerase and T4 polynucleotide kinase (for blunt-ends of DNA fragments; Invitrogen). cDNA libraries were constructed following the manufacturer's protocol (Illumina, Los Angeles, CA, USA) and subjected to sequencing on a HiSeq2500 platform (Illumina, Los Angeles, CA, USA) at Novogene. Raw data were filtered by removing adaptors and reads with unknown nucleotides more frequent than 10% as well as those with low quality (where PHRED values were less than 10 for more than 50% of the bases).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!