Anti p tyr 4g10

Manufactured by Merck Group

Sourced in United States

Anti–p-Tyr (4G10) is a laboratory reagent used for the detection and analysis of phosphorylated tyrosine residues in proteins. It is a monoclonal antibody that specifically binds to phosphorylated tyrosine, allowing for the identification and quantification of tyrosine phosphorylation events in various experimental settings.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

P-Tyr (6 citations) Anti-p-Tyr (3 citations)

10 protocols using anti p tyr 4g10

Investigating SYK and NF-κB Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Unless stated otherwise, all chemicals were purchased from MilliporeSigma. Antibodies were obtained from the following sources: anti–p-Tyr (catalog 9411), anti–p-SRC (Y416) (catalog 2101), anti-SRC (catalog 2109), anti–p-SYK (Y525/526) (catalog 2710), anti-SYK (catalog 2712), anti–p-IκBα (catalog 2859), anti-IκBα (catalog 9242), anti-GAPDH (catalog 2118), anti-TLR2 (catalog 12276 for human and 13744 for mouse), anti–NF-κB (catalog 3033), and anti–NF-κB (catalog 8242) from Cell Signaling Technology; anti-MyD88 (catalog SAB3500472) and anti-FLAG M2 (catalog F3165) from MilliporeSigma; anti-Myc (catalog sc-40) and anti-actin (catalog sc-47778) from Santa Cruz Biotechnology; anti-HA (M180-3) from MBL International; anti–p-Tyr (4G10) (catalog 05-321) from Millipore; anti-PPP1R11 (ab171960) from Abcam; and anti-3BP2 (catalog H00006452-M01) from Abnova. Halt Protease and Phosphatase Inhibitor Cocktail was from Thermo Fisher Scientific. SYK inhibitor was from Millipore. PP2 and BMS 345541 were from Selleckchem.

Matsumoto Y., Dimitriou I.D., La Rose J., Lim M., Camilleri S., Law N., Adissu H.A., Tong J., Moran M.F., Chruscinski A., He F., Asano Y., Katsuyama T., Sada K.E., Wada J, & Rottapel R. (2022). Tankyrase represses autoinflammation through the attenuation of TLR2 signaling. The Journal of Clinical Investigation, 132(7), e140869.

+ Open protocol

+ Expand

Immunoblotting Analysis of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells for immunoblotting were lysed in buffer containing 50 mM HEPES (pH 7.4), 150 mM NaCl, 1% Nonidet P‐40, 0.1% deoxycholate, 0.05% SDS, 1 mM EGTA, and a protease inhibitor. The protein concentration was determined using a Bio‐Rad protein assay kit (Bio‐Rad, Hercules, CA, USA). Proteins were separated on an 8%–12% polyacrylamide gel and transferred to a methanol‐activated PVDF membrane (Bio‐Rad, Trans‐Blot SD, Semi‐Dry Transfer Cell, USA). Proteins were blocked for 1 hr in Tris‐buffered saline and Tween‐20 (TBST) containing 5% milk and subsequently probed with primary antibodies overnight at 4°C. After incubation for 1 hr with goat anti‐rabbit or goat anti‐mouse horseradish peroxidase (HRP)‐conjugated secondary antibodies, the antigen–antibody complexes were visualized by chemiluminescence (PerkinElmer Life Sciences). The following antibodies were used for immunoblot analysis: anti‐c‐Abl (Santa Cruz, SC‐131), anti‐β‐actin (Santa Cruz, SC‐1616), anti‐pTyr (4G10; Millipore, 16–105), anti‐c‐Abl (Santa Cruz, SC‐131), anti‐Myc (Santa Cruz, SC‐40), and anti‐Flag horseradish peroxidase (Sigma, A8592), anti‐Bcl2 (Abcam) and anti‐Bax (Abcam).

Feng L., Sun Z., Liu Q., Ma T., Xu Z., Feng Z., Yuan W., Zhang H, & Xu L. (2020). Propofol inhibits the expression of Abelson nonreceptor tyrosine kinase without affecting learning or memory function in neonatal rats. Brain and Behavior, 10(11), e01810.

+ Open protocol

+ Expand

Tyrosine Phosphorylation Mapping of EphB4

Check if the same lab product or an alternative is used in the 5 most similar protocols

COS cells were transfected with 1 μg of pShuttle-IRES-hrGFP-2 expressing either empty vector, WT-EphB4-HA, or mutant-EphB4-HA. The mutant-EphB4-HA plasmids consisted of: Y574F-, Y581F-, Y590F-, Y596F-, Y614F-, Y653F-, Y730F-, Y736F-, Y774F-, Y806F-, Y821F-, Y837F-, Y906F-, or Y924F-substitution. After 24 hr starvation, the transfected Cos-7 cells were treated with Ephrin-B2/Fc (2 μg/ml) for 1 min. Cell lysates were then harvested and prepared. Whole cell lysates were then immunoprecipitated for the HA-tag. The IP sample underwent immunoblotting for both HA (Eph-B4) and pTyr using the primary antibodies anti-HA [Y-11] (Santa Cruz, #sc-805) and anti-pTyr [4G10] (Millipore, #05-321), respectively.

Protack C.D., Foster T.R., Hashimoto T., Yamamoto K., Lee M.Y., Kraehling J.R., Bai H., Hu H., Isaji T., Santana J.M., Wang M., Sessa W.C, & Dardik A. (2017). Eph-B4 regulates adaptive venous remodeling to improve arteriovenous fistula patency. Scientific Reports, 7, 15386.

+ Open protocol

+ Expand

Molecular Signaling Pathway Dissection

Check if the same lab product or an alternative is used in the 5 most similar protocols

MSCV-Pgk-PAC-CBL wild type and C381A mutant were kindly provided by Dr. E. Richard Stanley (Xiong et al. 2011 (link)). pOZ-hLNK wild type and R392E mutants were generated as described previously (Jiang et al. 2012 (link)). Human CBL miR30-based shRNA (CCCGTACTATCTTGTCAAG) was constructed into PIG (MSCV-puro-IRES-GFP) retroviral vector. LentiCas9-Blast vector was used for CAS9 expression. Human CBL-b gRNA (TTCCGCAAAATAGAGCCCCA) and human LNK knockout (GGTCGAAGAGCTCCAGCACG) were inserted into lentiGuide-Puro or RFP vector.
Antibodies for biochemical studies were purchased from the following vendors: anti-pY1007/1008-JAK2 (no. 3776), JAK2 (no. 3230), pY697-STAT5 (no. 9351), pS473-AKT (no. 4051), AKT (no. 9102), pT202/204-ERK1/2 (no. 9106), ERK1/2 (no. 9102), pY507-Lyn (no. 2731), Lyn (no. 2732), and pan-Ub (P4D1, no. 3936) antibodies were from Cell Signaling Technology, Inc.; STAT5 (sc-835), Actin (sc-1616), and CBL-b (sc-8006) were from Santa Cruz Biotechnology; anti-pTyr (4G10) was from Millipore; and CBL (610441) was from BC Biosciences. hLNK and MPL antibodies were generated as described previously (Bersenev et al. 2008 (link); Jiang et al. 2012 (link)).

Lv K., Jiang J., Donaghy R., Riling C.R., Cheng Y., Chandra V., Rozenova K., An W., Mohapatra B.C., Goetz B.T., Pillai V., Han X., Todd E.A., Jeschke G.R., Langdon W.Y., Kumar S., Hexner E.O., Band H, & Tong W. (2017). CBL family E3 ubiquitin ligases control JAK2 ubiquitination and stability in hematopoietic stem cells and myeloid malignancies. Genes & Development, 31(10), 1007-1023.

+ Open protocol

+ Expand

Characterization of BMX Phosphorylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Anti-pFAK (pY576/577), anti-pIGF1R (pY1165/1166)/InsR (pY1189/1190), anti-pMET (pY1234/1235), anti-pS6s235/236, anti-pPYK2Y579/580 and anti-pErbB2Y1221/1222 were from Cell Signaling Technology. Anti-Flag M2, anti-FAK, anti-pFAK (pY576), anti-pFAK (pY577), anti-BMX (H-220, sc20711, rabbit polyclonal) and anti-β-actin were from Santa Cruz Biotechnology. Anti-pTyr (4G10) and anti-tubulin were from Millipore. 3xFlag-FAK was produced by inserting FAK (pCMV-SPORT6-FAK, Open Biosystems) into p3XFlag-CMV (Sigma) between HindIII and BamH1 sites, and mutants were then generated using QuikChange Site-Directed Mutagenesis Kit (Stratagene). The BMX substrate antibody was generated in collaboration with Cell Signaling Technology (Beverly, MA). Rabbits were immunized with a BMX motif peptide, XX(D/E/S/T)pYpYXX (where X is any amino acid). The antibodies then were depleted of reactivity to the unphosphorylated and single phosphorylated peptides, and absorbed and eluted from resin conjugated with the dually phosphorylated peptide.

Chen S., Cai C., Sowalsky A.G., Ye H., Ma F., Yuan X., Simon N.I., Gray N.S, & Balk S.P. (2018). BMX-mediated regulation of multiple tyrosine kinases contributes to castration resistance in prostate cancer. Cancer research, 78(18), 5203-5215.

+ Open protocol

+ Expand

Western Blot Analysis of Angiogenesis Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein lysates from frozen tissues were prepared and Western Blots performed as previously described [41 (link)] using 10 to 25 µg total protein depending on the blot. Antibodies used include the following from Cell Signaling Technologies (Danvers, MA, USA; all of them used at 1:1000): anti-pAKT S473 (9271), anti-AKT (4685), anti-p4EBP1 (9459), anti-4EBP1 (9452), anti-pMAPK (9101), anti-MAPK (9102), anti-PTEN (9559), anti-FAK (3285), anti-VEGFR2 (2479) and anti-PDGFR-β (3169). Other antibodies were also used at 1:1000 except where indicated: anti-PTPN12 (Abcam, Cambridge, MA, USA; ab76492), anti-VEGFR1 (Abcam; ab32152), anti-VEGFR3 (Thermo Fisher Scientific; PA5-16871), anti-CD31 (Abcam; ab28364), anti-actin (Sigma-Aldrich; A5441, 1:10000), anti-VE-cadherin (Santa Cruz, Dallas, TX, USA; sc-6458), anti-pTyr 4G10 (Millipore, Billerica, MA, USA; 05-321), anti-pFAK (Sigma; F7926). Blots were imaged on a BioSpectrum Imaging System (UVP, Upland, CA, USA) and quantification of bands was performed using the instrument software.

Chadwick M.L., Lane A., Thomas D., Smith A.R., White A.R., Davidson D., Feng Y., Boscolo E., Zheng Y., Adams D.M., Gupta A., Veillette A, & Chow L.M. (2018). Combined mTOR and MEK inhibition is an effective therapy in a novel mouse model for angiosarcoma. Oncotarget, 9(37), 24750-24765.

+ Open protocol

+ Expand

Antibody and Reagent Sources for Cell Signaling Study

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antibodies and reagents used in this study were purchased from the following sources: anti-CDH1 (#3195) and anti-p-MLC (S19) (#3671) was from Cell Signaling (Danvers, MA, USA); anti-α-tubulin (#05-829) and anti-p-Tyr (4G10) (#16-316) was from Millipore (Billerica, MA, USA); anti-DDR1 was from Santa Cruz Biotechnology (sc-532, Santa Cruz, CA, USA); anti-PDPN was from Biocare Medical (CM 266, Pacheco, CA, USA); imatinib mesylate was from Sigma-Aldrich (SML1027, St. Louis, MO, USA); dasatinib was from Selleckchem (S1021, Houston, TX, USA). DDR1-IN-1 was from MedChemExpress (HY-13979, Monmouth Junction, NJ, USA). Type I and type IV collagens were from BD Biosciences (San Jose, CA, USA).

Chen Y.L., Tsai W.H., Ko Y.C., Lai T.Y., Cheng A.J., Shiah S.G., Hsiao J.R., Chang J.Y, & Lin S.F. (2020). Discoidin Domain Receptor-1 (DDR1) is Involved in Angiolymphatic Invasion in Oral Cancer. Cancers, 12(4), 841.

+ Open protocol

+ Expand

Western Blotting Antibody Panel

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used for Western blotting: anti-β-actin (A4700; 1:5000; Sigma-Aldrich, Oakville, Canada), anti-LC3B (NB600-1384; 1:1000 for WB; 1:200 for IF; Novus Biologicals; Oakville, Canada), anti-p62 (610832; 1:1000; BD Transduction; Mississauga, Canada), anti-pTyr (4G10; 1:500; EMD Millipore, Etobicoke, Canada), anti-CagA (b-300; 1:500; Santa Cruz, Dallas, TX), anti-Ubiquitin (P4D1; 1:500; Santa Cruz, Dallas, TX), anti-Atg12 (2010; 1:500; Cell Signaling, Whitby, Canada) goat anti-mouse IgG (115-035-003; 1:2500; Jackson ImmunoResearch, West Grove, PA), and goat anti-rabbit IgG (115-035-144; 1:2500; Jackson ImmunoResearch, West Grove, PA).

Abdullah M., Greenfield L.K., Bronte-Tinkew D., Capurro M.I., Rizzuti D, & Jones N.L. (2019). VacA promotes CagA accumulation in gastric epithelial cells during Helicobacter pylori infection. Scientific Reports, 9, 38.

+ Open protocol

+ Expand

Immunoblotting Analysis of Cellular Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole cell lysates were prepared and the immunoblotting was done as previously described [3 (link)] in Triton X 100-containing lysis buffer (50 mM Tris–HCl, pH 7.5, 10% glycerol, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 50 mM NaF). For Western blotting, the following antibodies were used: pAKT (S473, #6942), AKT (#9272), Bcl-xL (#2764), p ERK1/2 (#9101), MEK1/2 (#4694), pMEK1/2 (#9121), ERK1/2 (#4696), NF-κB p65 (#6956), pNF-κB p65 (#3033), PARP (#9532), PI3K p85α (#13,666), pPI3K p85/p55 (#4228), PTK7 (#25618), Rac-1 (#4651), RhoA (#2117), ROR1 (#16,540), ROR2 (#88,639), Src (#2109), STAT3 (#9139), pSTAT3 (#9145) from Cell Signaling Technology (CST, Danvers, MA, USA); anti-pTYR 4G10 (#05–321) from Merck Millipore (Burlington, MA, USA); β-tubulin (#sc-166729) from Santa Cruz Biotechnology (Dallas, TX, USA); HA (#901,513) from BioLegend (San Diego, CA, USA). As secondary antibodies, IRDye^® 800CW Donkey anti-Mouse IgG or IRDye^® 680RD Donkey anti-Rabbit IgG (LI-COR, Lincoln, NE, USA) were used at 1:10 000 dilution.

Raivola J., Dini A., Salokas K., Karvonen H., Niininen W., Piki E., Varjosalo M, & Ungureanu D. (2022). New insights into the molecular mechanisms of ROR1, ROR2, and PTK7 signaling from the proteomics and pharmacological modulation of ROR1 interactome. Cellular and Molecular Life Sciences, 79(5), 276.

+ Open protocol

+ Expand

Antibody-based Protein Signaling Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Unless stated otherwise, all chemicals were purchased from Sigma. Antibodies were obtained from the following sources: anti-pABL (Y245) (Cell Signaling Technology), anti-ABL (BD Pharmingen), anti-Flag M2 (Sigma), anti-Actin (Santa Cruz Biotechnologies), anti-RUNX2 (MBL International) and anti-pTyr (4G10) (EMD Millipore) antibodies. Halt™ Protease and Phosphatase Inhibitor Cocktail was from Thermo Fisher Scientific.

He F., Matsumoto Y., Asano Y., Yamamura Y., Katsuyama T., La Rose J., Tomonobu N., Komalasari N.L., Sakaguchi M., Rottapel R, & Wada J. (2021). RUNX2 Phosphorylation by Tyrosine Kinase ABL Promotes Breast Cancer Invasion. Frontiers in Oncology, 11, 665273.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!