Index and sequencing adapters

DNA extraction and microbial analysis were performed in the University of North Carolina at Chapel Hill School of Medicine Microbiome Core Facility (UNC: MC). We identified a conserved region of the 16S rRNA gene of 550 bp to amplify. This encompassed variable regions V3–V4 from the colon genomic DNA using primers 16S rRNA-F 5′-AGAGTTTGATCCTGGCTCAG-3′and 16S rRNA-R 5′-GCTGCCTCCCGTAGGAGT-3′ and overhang adapter sequences appended to the primer pair for compatibility with Illumina index and sequencing adapters. Briefly, each 16SrRNA amplicon was purified using AMPure XP reagent (Beckman Coulter, Indianapolis, IN, USA). Specifically, each sample was amplified using a limited cycle PCR program, adding Illumina sequencing adapters and optional dual-index barcodes [index 1(i7) and index 2(i5)] (Illumina, San Diego, CA, USA) to the amplicon target. The final libraries were purified using AMPure XP reagent, quantified and normalized prior to pooling. The DNA library pool was denatured with NaOH, diluted with hybridization buffer and heat denatured before loading on to the MiSeq reagent cartridge and to the MiSeq instrument (Illumina). The standard Illumina paired-end 250 base pair (PE250) protocol was used for sequencing the16S rRNA amplicons (Illumina, CA, USA).

DNA was amplified using primers targeting the V1-V2 region of the bacterial 16S rRNA gene [15 (link), 43 (link)] and overhang adapter sequences appended to the primer pair for compatibility with Illumina index and sequencing adapters. The complete sequences of the primers are listed in Table 1. Master mixes contained 12.5 ng of total DNA and 2× KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, MA). Negative controls, not containing template, were amplified for all barcode-primer sets. Each 16S amplicon was purified using AMPure XP reagent (Beckman Coulter, Brea, CA). In the next step each sample was amplified using a limited cycle PCR program, adding Illumina sequencing adapters and dual- index barcodes (index 1(i7) and index 2(i5)) (Illumina, San Diego, CA) to the amplicon target. The final libraries were again purified using AMPure XP reagent (Beckman Coulter), quantified and normalized prior to pooling. The DNA library pool was then denatured with NaOH, diluted with hybridization buffer and heat denatured before loading on the MiSeq reagent cartridge (Illumina) and on the MiSeq instrument (Illumina). Automated cluster generation and paired-end sequencing with dual reads were performed according to the manufacturer’s instructions.

A ∼ 250 bp region of the ribosomal RNA (rRNA) internal transcribed spacer (ITS1) was amplified from each DNA sample using nested PCR with primer pairs 18Ph2F and 5.8S-1R in the first round and ITS6 and 5.8S-1R in the second round according to the protocol of Scibetta et al. (2012) (link), except that proof-reading enzyme KAPA HiFi HotStart ReadyMix (KAPA Biosystems, Wilmington, MA, USA) was used for the PCR reaction to minimise errors during PCR. Second round primers were amended with overhang adapters to ensure compatibility with the Illumina index and sequencing adapters. These were: forward overhang; 5′ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐ [ITS6] and reverse overhang; 5′ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐ [5.8S-1R] (Illumina, 2013 ). For each DNA sample, PCR was carried out in triplicate and all Phytophthora-positive PCR replicates were pooled for downstream processing.