The HOTAIR gene was amplified by RT-PCR and then cloned into a lentiviral vector pCDH-MSCV-mcs-EF1-GFP-T2A-Pu (SBI) at EcoR1 and Not1 sites using the Cold Fusion kit (SBI). To generate HOTAIR overexpression stable cells, cells were transduced with control or HOTAIR overexpression lentivirus particles and selected with puromycin for 3 days. HOTAIR knockdown construct was created by inserting oligo (CCGGGAACGGGAGTACAGAGAGAATCTCGAGATTCTCTCTGTACTCCCGTTCTTTTTG) into the pLKO.1 vector. Lentiviral particles were generated by transfecting 293T cells with packaging vectors, psPAX2 and pMD2.g. All primers were designed using Primer 3 and synthesized by Integrated DNA Technologies (Table S4 ). The qRT-PCR was performed using Bullseye EvaGreen qPCR SYBR Green Mastermix (MIDSCI) on an Applied Biosystems StepOne Plus. A detailed list of other plasmids and reagents used in this study is provided in the Supplemental Experimental Procedures .
Bullseye evagreen qpcr sybr green mastermix
Manufactured by MidSci
Bullseye EvaGreen qPCR SYBR Green Mastermix is a ready-to-use solution for quantitative real-time PCR (qPCR) experiments. It contains SYBR Green I, a fluorescent dye that binds to double-stranded DNA, and all the necessary components for qPCR amplification.
Automatically generated - may contain errors
2 protocols using bullseye evagreen qpcr sybr green mastermix
1
HOTAIR Overexpression and Knockdown Protocol
2
HOTAIR Overexpression and Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HOTAIR gene was amplified by RT-PCR and then cloned into a lentiviral vector pCDH-MSCV-mcs-EF1-GFP-T2A-Pu (SBI) at EcoR1 and Not1 sites using the Cold Fusion kit (SBI). To generate HOTAIR overexpression stable cells, cells were transduced with control or HOTAIR overexpression lentivirus particles and selected with puromycin for 3 days. HOTAIR knockdown construct was created by inserting oligo (CCGGGAACGGGAGTACAGAGAGAATCTCGAGATTCTCTCTGTACTCCCGTTCTTTTTG) into the pLKO.1 vector. Lentiviral particles were generated by transfecting 293T cells with packaging vectors, psPAX2 and pMD2.g. All primers were designed using Primer 3 and synthesized by Integrated DNA Technologies (Table S4 ). The qRT-PCR was performed using Bullseye EvaGreen qPCR SYBR Green Mastermix (MIDSCI) on an Applied Biosystems StepOne Plus. A detailed list of other plasmids and reagents used in this study is provided in the Supplemental Experimental Procedures .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!