Gel doc ez

Incision of 2 μM abasic substrate model oligonucleotide was assayed at 37 °C in buffer 20 mM potassium phosphate, 50 mM NaCl, 5 mM MgCl₂, 2 mM DTT, pH 7.0, and monitored by denaturing 18% polyacrylamide (PA)-urea gels [20 (link)]. The samples were incubated during 0–30 min at 37 °C in the presence of 5 nM (unlabelled, Cy3-, Cy5-APE1) or 500 nM (DL-APE1) enzyme. Reactions were halted by the addition of the same volume of loading solution containing 96% formamide, 10 mM EDTA and 0.1% bromophenol blue, and heating the sample at 95 °C for 5 min, prior to electrophoresis. “Product” oligonucleotide was also loaded as a reference. Ten well, 1 mm thick, 18% PA gels containing 8 M urea were pre-run for 30 min, loaded with 20 μL of sample per well, and run for 140 min at 175 V. Gels were stained with GelRed and analysed for densitometry with Gel Doc EZ and Quantity One (Bio-Rad).

Single-cysteine-containing EFSAM-GrpE variants were labelled either singly with fluorescein-5-maleimide (Thermo) or Alexa Fluor 594 C₅ maleimide (Thermo), or with both fluorophores, for in vitro energy transfer measurements. Each protein sample, ~100 μM in 50 mM Tris pH 7.5, 150 mM NaCl, was first treated with 10 mM TCEP for at least 1 h to reduce any disulfide bonds. Excess TCEP was removed by passing the fully reduced protein sample through an Amicon 30 kDa device with a quick buffer exchange using 50 mM Tris pH 7.5, 150 mM NaCl buffer. Dye working stocks (10–20 mM) were prepared in anhydrous DMF immediately prior to use. A 10-fold molar excess of the fluorescent dyes was added slowly to the protein and incubated at 4 °C for 1 h. The labelled protein was passed through a PD-10 desalting column (GE Healthcare) and further concentrated. Labelled proteins yielded a ~ 0.8-0.9:1 molar ratio of fluorophore to protein, based on measuring the absorbance at 495 nm (fluorescein-5-maleimide, ε₄₉₅ = 68,000 M^-1 cm^-1), 588 nm (Alexa Fluor 594 C₅ maleimide, ε₅₈₈ = 96,000 M^-1 cm^-1), and 280 nm (protein, ε₂₈₀ = 34,950 M^-1 cm^-1). Dye conjugation to each protein was further confirmed by resolving the labelled proteins on a 4–12% NuPAGE gel (Life Technologies) and imaging under a broad-range UV light using Gel Doc EZ (Bio-Rad).

Binding experiments were carried out by incubating the 6-FAM-labeled ss DNA or RNA probes corresponding to the SARS-CoV-2 targets with the corresponding PPRHs in a buffer containing 10 mM MgCl₂, 100 mM NaCl, and 50 mM HEPES (pH 7.2), supplemented with 5% glycerol. Binding reactions (20 μL) were incubated 30 min at 37 °C. A scrambled PPRH (HpSC6: AAGGAAGGAAGGAAGGAAGGAAGGTTTTTGGAAGGAAGGAAGGAAGGAAGGAA) was used as negative control. Electrophoresis was performed on nondenaturing 8% polyacrylamide gels containing 10 mM MgCl₂, 5% glycerol, and 50 mM HEPES (pH 7.2). Gels were run at a fixed voltage of 190 V (4 °C) using a running buffer containing 10 mM MgCl₂ and 50 mM HEPES (pH 7.2). Finally, gels were visualized using the Gel Doc™ EZ with the Image Lab Software, Version 6.0 (Bio-Rad, Barcelona, Spain). All reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA).

The binding capacity of the MagNPs for the DNA plasmids containing the genes encoding GFP and DsRed was determined by agarose gel electrophoresis using the Gel Doc EZ gel imaging system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The gels contained 1% (w/v) agarose in 100 ml of TAE buffer (200 mM Tris, 200 mM acetic acid, and 5 mM EDTA) containing 3 µl of ethidium bromide (0.5 µg/ml) as a stain. To prepare the MagNP-DNA complexes for single gene expression, 1 µg of the GFP or DsRed plasmid was used. For multiple-gene expression, a solution containing 0.4 µg of the GFP plasmid and 0.6 µg of the DsRed plasmid was used. Complexes with DNA:MagNP weight ratios of 0.1∶1 to 20∶1 were prepared at pH 7.4. After incubation at room temperature for 30 min to allow complex formation, the samples were electrophoresed in a 1% (w/v) agarose gel for 30 min at 90 V.

Supercoiled plasmid DNA, pBluescriptII (500 ng, Fig. 2b) or pUC18 (100 ng, Fig. 2c), was incubated in 20 μl of 1×CutSmart buffer with 0.025 U of E. coli Topoisomerase1 (NEB) and increasing amounts of rVpr (0.71, 2.36, 7.1 pmol and 0.63, 2, 6.32 pmol for Fig. 2b, c, respectively) for 30 min at 37 °C. After that, samples were heat-inactivated for 20 min at 80 °C, and incubated for 20 min at 55 °C with 0.5% SDS and Proteinase K (1 mg/ml) for de-proteinisation. Following phenol–chloroform extraction, purified DNA was separated on 0.8% agarose gel, and stained with ethidium bromide or 1×SyBr Gold (Life technologies) (Fig. 2b, c, respectively). Images were captured by GelDoc Ez (BioRad), and the intensity of each topoisomers was analysed by Image Lab software (BioRad).