Takara s reverse transcription kit

The total RNA was extracted from brain and lung tissues using RNAiso plus reagent (Takara, Dalian, China). The RNA concentration was measured using Nanodrop (ThermoFisher, USA) and 1 mg of total RNA was used to synthesize cDNA using Takara’s reverse transcription kit (Takara, Dalian, China). The RT-qPCR was carried out with SYBR green mix according to instructions (Takara, Dalian, China). The sequences of primers are listed in Table.

Total RNA was extracted from cells and tissue samples using Trizol reagent (Invitrogen, USA) according to the manufacturer's protocol. cDNA was synthesized from 2 µg of total RNA with Takara's reverse transcription kit (Takara, China), according to manufacturer's instructions in a 25 µL volume including 2 µg total RNA, and reverse transcription primer for mRNA genes, or random primers for U6 rRNA and miR-208a specific primers (Bulge-Loop miRNA qPCR Primers from RiboBio, China). Real-time PCR was carried out with the reagents of a Sybr green I mix (Takara, China) in a 20 µL reaction volume (10 µL Sybr green I mix, 200 mM forward and reverse primer, and 2 µL cDNA template) on an MJ Opticon Monitor chromo4 instrument (Bio-Rad, USA) using the following protocol: 95°C for 20 s; 40 cycles of 95°C for 10 s, 60°C for 20 s, and 70°C for 1 s. Normalization for miR-208a was done using U6 while Bax expression was normalized using GAPDH. U6 and Bulge-Loop miRNA qPCR Primers were from RiboBio, China. The following primer sets were used for BAX and GAPDH: 

BAX:

 

Forward: TGTTTGCTGATGGCAACTTC

 

Reverse: GATGGTTCTGATCAGCTCGG

 

GAPDH:

 

Forward: 5′-GCTGGCGCTGAGTACGTCGTGGAGT-3′

 

Reverse: 5′-CACAGTCTTCTGGGTGGCAGTGATGG-3′

Data analyses were performed using the 2^−ΔΔCt method.