Mir 195 5p mimic

Human normal esophageal epithelial cells (HEEC) and ESCC cell lines EC9706, Eca109, TE-13, TE-1 and TTN were provided by China Center for Type Culture Collection (Wuhan, China). Cells (3 × 10⁵ cells/well) with 80% confluence were subjected to transfection using Lipofectamine 2000 (Invitrogen, CA, United States). Overexpressed (oe)-VEGFA, small interfering RNA (si)-LINC00662, oe-LINC00662, miR-195-5p mimic and their corresponding negative control (NC) were all from GenePharma (Shanghai, China) (Li Z et al., 2019 (link)).

si-circ-FURIN (si-circ-FURIN 1#: AACCAGTGTGCGAGGAAGGCT, si-circ-FURIN 2#: ACCAGTGTGCGAGGAAGGCTT), si-negative control (nc; UUCUCCGAACGUGUCACGUTT), miR-195-5p inhibitor (GCCAAUAUUUCUGUGCUGCUA) and negative control inhibitor (CAGUACUUUUGUGUAGUACAA), miR-195-5p mimic (UAGCAGCACAGAAAUAUUGGC) and negative control mimic (UUCUCCGAACGUGUCACGUTT), empty vector, and BCL2 overexpression vector were obtained from GenePharm (Shanghai, China). Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) was used for transient transfection following the manufacturer’s instrument. Forty-eight hours later, transfection efficiency was examined using RT-qPCR.

Human umbilical vein endothelial cells (HUVECs; ATCC) were cultured with CC-3162 EGM-2 Bulletkit (Lonza, MD, United States). According to the instructions of Lipofectamine 2000 (Invitrogen, Carlsbad, CA, United States) and opti-MEM reduced serum medium (GIBCO life technologies, Grand Island, NY, United States), the cells cultured for 24h in 12-well plates were treated with miR-195-5p inhibitor, miR-195-5p mimic, si-smad7, or corresponding controls (GenePharma). After 6h, opti-MEM reduced serum medium was replaced by complete cell culture medium with high concentration of glucose (HG: 25mmol/L, D-glucose, G5500, Sigma-Aldrich) and negative control (NG: 25mmol/L, L-glucose, G8644, Sigma-Aldrich) for 48h (Li et al., 2020 (link)). In order to further verify the regulatory effect of TGF-β1/smads pathway, HUVECs were stimulated using 3μmol/L TGF-β1R-I inhibitor LY-364947 (LY, # 54678S, CST, Beverly, MA, United States) for 24h (Che et al., 2020 (link)). The cell treatment process was shown in Supplementary Figure 2.

RNA was extracted from tissue and cell samples using RNAiso (TAKARA, Beijing, China) according to the manufacturer’s instructions and reverse-transcribed using the Mir-X miRNA first-strand strand synthesis system (TAKARA, Beijing, China). Finally, quantitative PCR was used to detect the relative expression of mir-195-5p in multiple samples and U6 RNA was used as an endogenous control. mir-195-5p sense primer was 5′- CGTAGCAGCACAGAAATATTGGC -3′.
Mir-195-5p mimics were designed and synthesized by the Gene Pharma Corporation (Shanghai, China), mir-195-5p was transfected into Huh7 and MHCC97L cells using lipo2000, and media were freshly replaced after 24 h.

The short-hairpin RNA (shRNA) targeting LIPE-AS1 (sh-LIPE-AS1), LIPE-AS1 over-expressing plasmids, miR-195-5p mimics, and inhibitors as well as their negative controls were obtained from Shanghai GenePharma Co., Ltd. (Shanghai, China). HCC94 and Hela cells were seeded in the 24-well plates with 2 × 10⁵ cells each well. Lipofectamine 2000 reagent (Sangon Biotech, Shanghai, China) was applied for cell transfection according to the manufacturers' protocol.

Human MDA-MB-231 breast cancer and HEK293T cells were purchased from the Chinese Science Institute (Shanghai, China). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) (both from Gibco, USA), penicillin (100 U/ml) and streptomycin (100 μg/ml) (Enpromise, Hangzhou, China) at 37°C with 5% CO₂ in saturated humidity. Cells in the logarithmic growth phase (~80% confluence) were selected for the experiments. Those with over 95% viability as shown by trypan blue staining were qualified for further experiments.
miR-195-5p mimics and non-specific negative control (NC) oligos were purchased from GenePharma (Shanghai, China). The sequence of the miR-195-5p mimic was 5′-UAGCA GCACAGAAAUAUUGGC-3′ and the sequence of the NC mimic was 5′-UCACAACCUCCUAGAAAGAGUAGA-3′. For transfection, MDA-MB-231 cells (2×10⁵) were added into each well of a 6-well plate and cultured with serum- and antiobiotic-free DMEM. When the cell density achieved 30–40% confluence, Lipofectamine transfection reagent (Invitrogen, USA) was used to introduce the mimics according to the manufacturer’s instructions. The ratio of mimics to Lipofectamine was 1 μg to 3 μl.