Hotstart readymix

PCR was performed using universal primers flanking the variable 4 (V4) region of the bacterial 16 S rRNA gene44 (link). A total of 50 ng DNA, 0.4 μM each primer, 12.5 μl 2X HotStart ReadyMix (KAPA Biosystems, Wilmington, MA, USA), and water to 25 μl were used for one reaction per sample. Cycling conditions were as follows: initial denaturation of 95 °C for 3 min followed by 25 cycles of 95 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, with a final extension at 72 °C for 5 min. PCR products were purified by gel extraction from a 1.0% low-melt agarose gel (National Diagnostics, Atlanta, GA) using a ZR-96 Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA). Samples were quantified by Qubit^® Fluorometer and equimolar pooled. The pool plus 5% PhiX control DNA was sequenced with the MiSeq 2 × 250 v2 kit (Illumina, San Diego, CA, USA) using custom sequencing primers44 (link).

The purified linkage product was amplified using 2X HotStart ReadyMix® and 10X Library Amplification Primer Mix® (KAPA Biosystems™, Massachusetts USA). Amplicons were purified using Streptavidin Magnetic Beads and the quality of the genomic DNA library was assessed on an Agilent™ 2100 Bioanalyzer®, following adjusting of concentration to 3ng/µL.
Hybridization was performed according to the standard hybridization protocol [16 (link)]. Briefly, a reaction mixture was prepared and subjected to PCR. Streptavidin Magnetic Beads (SA Beads) were used to capture and purify hybridized products, following manufacturer guidelines. The captured library prep was amplified using 2X HotStart ReadyMix® solution and 10X Library Amplification Primer Mix®, following measurement of library concentration.

PCR was performed using primers 515F and 806R for the variable 4 (V4) region of the bacterial 16S rRNA gene [21 (link)]. PCR reactions contained 1 ng μl^-1 DNA, 10 μM each primer, 12.5 μl 2X HotStart ReadyMix (KAPA Biosystems, Wilmington, MA, USA), and water to 25 μl. PCR program was 95°C for 3 min, then 30 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, the final step was 72°C for 5 min. PCR products were purified by gel extraction from a 1.5% low-melt agarose gel using a Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA). Samples were quantified using the Qubit dsDNA HS assay (Invitrogen, Carlsbad, CA, USA) and equimolar concentrations pooled. The pool was sequenced with the MiSeq 2x250 v2 kit (Illumina, San Diego, CA, USA). All DNA sequences generated in this study are deposited in the NCBI Short Read Archive under BioProject Accession Number: PRJNA595821 and PRJNA596889.

Genomic DNA was isolated from DMD53 GFP-reporter cells, HEK293T cells or myoblasts (isolated from mice as described above) with the DNeasy Blood & Tissue Kit (Qiagen). Three different DNA regions were amplified for next-generation sequencing. The DMD exon 53 target sequence in the GFP-reporter cassette of GFP-reporter cells was amplified with primers reporter-mut-F1 and reporter-R2. The endogenous human DMD exon 53 target region was amplified with primers DMD53-F and DMD53-R. The cDNA sequence of human DMD exon 53 was amplified from cDNA with primers DMD51-EX-F and DMD54-R1, which could detect exon 53 skipping. The 100~350 bp PCR products were recovered from the gel (to exclude mouse Dmd cDNA derived amplicons (S2 Table for primer sequences).
Genomic DNA template input for PCR was up to 0.5 μg if possible. For samples with low DNA concentration, 0.2 μg of DNA was used. Predetermined minimal cycling numbers (25–30) were used to reduce amplification bias. The proofreading HotStart^® ReadyMix from KAPA Biosystems (Wilmington, MA) was used for PCR. The PCR products were purified with the NucleoSpin Gel and PCR Clean-Up kit (Takara) and NGS was done at Genewiz with the Amplicon-EZ service (GENEWIZ, Morrisville, NC). Sequence analyses were done with online software Cas-Analyzer [43 (link)] and crispresso2 [44 (link)] for mutation analyses.

Genomic DNA was isolated from cultured cells with the DNeasy Blood & Tissue Kit (Qiagen). The DNA region containing the target sequences were amplified by the proofreading HotStart ReadyMix from KAPA Biosystems (Wilmington, MA). PCR primers used for amplifying each target sequence were listed in Table S2. The purified PCR products were shipped to Genewiz Inc. (Morrisville, NC) to perform next generation sequencing using the Amplicon EZ service. Usually 50,000 reads/amplicon were obtained. Analysis of insertions and deletions (INDEL) was done with the online Cas‐Analyzer software (Park et al., 2017) and CRISPRESSO2 (Clement et al., 2019), which gave very similar results.

The expression plasmid using the pQE-31 (Qiagen) backbone was constructed employing an In-Fusion^® HD Cloning Kit (Clontech Laboratories). The target cluster bphAE_AVS was amplified from the ¹³C-enriched DNA using HotStart ReadyMix (KAPA Biosystems) employing the primers AVS_F (5′-GAGGAGAAATTAACTATGAGTACGACGATGAAGGAA) and AVS_R (5′-AACAGGAGTCCAAGCTTAGAAGAACATG CTGAGGTTGTTCG; the 15 bp overlap sequences on the 5′-ends enabling cloning by the In-Fusion^® HD Cloning Kit are underlined). The backbone of pQE31 was inverse PCR-amplified using the primers pQE_F (5′- GCTTGGACTCCTGTTGATAGATCC) and pQE_R (5′- AGTTAATTTCTCCTCTTTAATGAATTCTGTGTG) (Supplementary Figure 1). Both fragments were then fused using the In-Fusion^® HD Cloning Kit, yielding the plasmid pQE31-bphAE_AVS, in which the genes bphAE_AVS are located 8 bp downstream from the pQE-31 E. coli-consensual ribosome binding site; the DNA span encoding for the His-tag was omitted from the original plasmid sequence. The nucleotide sequence of the insert was verified by Sanger sequencing. The resulting plasmid, pQE31-bphAE_AVS, was used for the transformation of E. coli DH11S competent cells already hosting pYH31-bphFGBC_LB400. Upon their selection in the presence of a combination of ampicillin and kanamycin, grown colonies were PCR-screened for the presence of both plasmids and used for BPDO-heterologous expression assays.