Exorneasy midi kit

Manufactured by Qiagen

Sourced in Germany, United States

The ExoRNeasy Midi Kit is a laboratory product designed for the isolation and purification of extracellular RNA (exRNA) from various sample types, including cell culture media, plasma, serum, and other biofluids. The kit utilizes a silica-based membrane technology to capture and purify exRNA molecules, enabling their subsequent analysis and downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (21 mentions) Abi 7900 system, by Thermo Fisher Scientific (6 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions) Primescript rt reagent kit, by Takara Bio (6 mentions) Sybr green assay, by Takara Bio (5 mentions) Sybr premix ex taq 2, by Takara Bio (5 mentions) Sybr green master mix, by Qiagen (3 mentions) Mircury lna rt kit, by Qiagen (3 mentions) Mir x mir first strand synthesis kit, by Takara Bio (3 mentions) Agilent 2100 bioanalyzer, by Agilent Technologies (3 mentions) Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (3 mentions) Qiazol lysis reagent, by Qiagen (2 mentions) Maxtract high density tube, by Qiagen (2 mentions) Sybr premix ex taq, by Qiagen (2 mentions) Total exosome isolation kit, by Thermo Fisher Scientific (2 mentions) Exoeasy maxi kit, by Qiagen (2 mentions) Qiaseq mirna library kit, by Qiagen (2 mentions) Human serum plasma mircury lna mirna pcr array, by Qiagen (2 mentions) Mircury lna sybr green pcr kit, by Qiagen (2 mentions) Millex gv, by Merck Group (2 mentions)

Spelling variants of this product

Midi Kit (79 citations) ExoRNeasy Serum/Plasma Midi Kit (78 citations) ExoRNeasy kit (28 citations) ExoRNeasy (6 citations) ExoRNeasy Midi/Maxi Kit (3 citations)

67 protocols using exorneasy midi kit

RNA Isolation from EV Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

To isolate RNA from EVs captured by MEM, we used the exoRNeasy midi kit, according to the manufacturer's instructions (Qiagen, Hilden, Germany). As an RNA isolation control, QIAzol Lysis reagent (Qiagen) for all samples was spiked with synthetic RNA controls (UniSp2, UniSp4, UniSp5 from the Qiagen miRCURY® spike‐in kit), according to the manufacturer's instructions. MaXtract High‐Density tubes (Qiagen) were used for phase separation. The aqueous phase was mixed 1:2 with 100% ethanol and loaded into RNeasy MinElute spin column from the kit. EV miRNA was eluted from columns in 25 μl water.
EVs were purified from plasma with qEV columns, concentrated (as described above), and homogenized in 700 μl QIAzol Lysis reagent spiked with synthetic RNA controls as for the MEM‐purified samples. Phase‐separation and RNA purification with RNeasy MinElute spin columns from the exoRNeasy midi kit (Qiagen) was done as described above.

Doncheva A.I., Romero S., Ramirez‐Garrastacho M., Lee S., Kolnes K.J., Tangen D.S., Olsen T., Drevon C.A., Llorente A., Dalen K.T, & Hjorth M. (2022). Extracellular vesicles and microRNAs are altered in response to exercise, insulin sensitivity and overweight. Acta Physiologica (Oxford, England), 236(4), e13862.

+ Open protocol

+ Expand

Exosomal RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole-RNA extracts were prepared using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and total RNA from exosomes was isolated with the exoRNeasy Midi Kit (Qiagen, Valencia, CA, USA) according to the standard procedure. Then extracted RNA was interacted with Rnase R (Epicentre, Madison, WI, USA), followed by incubation with RNeasy MinElute Cleanup Kit (Qiagen). RNA samples were reversely transcribed into cDNA using a High Capacity cDNA Reverse Transcription Kit (Qiagen), and cDNA amplification was carried out with SYBR Premix Ex Taq (Qiagen). Glyceraldehyde 3-phosphate dehydrogenase (GADPH) and U6 small nuclear B noncoding RNA (U6) were used as internal references to normalize the fold changes using 2^−ΔΔCt method. The specific primer sequences were listed as follows:

Hu K., Liu X., Li Y., Li Q., Xu Y., Zeng W., Zhong G, & Yu C. (2020). Exosomes Mediated Transfer of Circ_UBE2D2 Enhances the Resistance of Breast Cancer to Tamoxifen by Binding to MiR-200a-3p. Medical Science Monitor : International Medical Journal of Experimental and Clinical Research, 26, e922253-1-e922253-12.

+ Open protocol

+ Expand

Quantitative Analysis of RNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from NSCLC cells and tumor tissues was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and total RNA from exosomes was isolated with the exoRNeasy Midi Kit (Qiagen, Valencia, CA, USA) following the standard procedure. Then, total RNA was reversely transcribed into complementary DNA (cDNA) using All-in-One™ Kit (FulenGen, Guangzhou, China). After that, qRT-PCR was performed by SYBR™ Green Master Mix (Qiagen). Relative transcription alterations were analyzed by 2^−ΔΔCt method and normalized by GADPH or U6. The specific primer sequences were listed as follows: MALAT1: F, 5ʹ-TCTTAGAGGGTGGGCTTTTGTT-3ʹ and R, 5ʹ-CTGCATCTAGGCCATCATACTG-3ʹ; EEF2: F, 5ʹ-GAGCTCTCCGAGAACGACC-3ʹ and R, 5ʹ-TACAGTGCCCAGGACAGGAT −3ʹ, miR-515-5p: F, 5ʹ-TTCTCCAAAAGAAAGCACTTTCTG-3ʹ and R, 5ʹ-TGGTGTCGTGGAGTCG-3ʹ; GADPH: F 5ʹ-GAGAAACCTGCCAAGTATGATGAC-3ʹ and R 5ʹ-GGAGTTGCTGTTGAAGTCAC-3ʹ, U6: F, 5ʹ-CTCGCTTCGGCAGCACA-3ʹ and R, 5ʹ-ACGCTTCACGAATTTGCGT-3ʹ.

Rong F., Liu L., Zou C., Zeng J, & Xu Y. (2020). MALAT1 Promotes Cell Tumorigenicity Through Regulating miR-515-5p/EEF2 Axis in Non-Small Cell Lung Cancer. Cancer Management and Research, 12, 7691-7701.

+ Open protocol

+ Expand

Exosomal Small RNA Sequencing and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

For small RNA sequencing, total exosomal RNA was isolated from 400 μL plasma, using an exoRNeasy Midi Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. For real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR), total exosomal RNA was extracted from 200 μL plasma or serum using a Total Exosome Isolation Kit (Cat no: 4484450, Invitrogen) and an miRNeasy serum/plasma Kit (Qiagen, Valencia, CA).

Nishiwada S., Cui Y., Sho M., Jun E., Akahori T., Nakamura K., Sonohara F., Yamada S., Fujii T., Han I.W., Tsai S., Kodera Y., Park J.O., Von Hoff D., Kim S.C., Li W, & Goel A. (2021). Transcriptomic profiling identifies an exosomal microRNA signature for predicting recurrence following surgery in patients with pancreatic ductal adenocarcinoma. Annals of surgery, 276(6), e876-e885.

+ Open protocol

+ Expand

Extracellular Vesicle RNA Extraction

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Normal single donor human plasma, frozen once, was obtained from Innovative Research (10 mL, #IPLA-N-S, Novi, MI, USA), and EVs extracted as described previously (Section 2.3 EV Extraction in Banack et al. [11 (link)]). We used the T−N fraction of the EV preparations for these experiments. T−N represents the total heterogeneous EV population minus the EVs positive for L1CAM/CD171 neural surface proteins, designated NEE [11 (link)].
The RNA extraction kit containing the RNeasy MinElute Spin Columns was from Qiagen (ExoRNeasy Midi Kit #77144, Hilden, Germany). The RNA Tini Spin columns were from Enzymax LLC (Lexington, KY, USA, #EZC107N). Although the RNeasy MinElute Spin Columns from Qiagen cannot be purchased as a separate item, the lysis and wash buffers used in the total RNA extraction process that retains short RNA (<200 nt) are available. QIAzol lysis reagent 50 mL #79306, Buffer RPE (concentrate 55 mL) # 1018013, Buffer RWT (80 mL) #1067933, miRCURY RNA spike-in kit, for RT (containing UniSp2, 4, 5 and cel-miR-39-3p) #339390, and the miRCURY LNA RT Kit containing UniSp6 #339340 were from Qiagen. Chloroform ≥99%, stabilized, molecular biology grade #0219400225 was from MP Biomedicals. Ethyl alcohol, pure 200 proof for molecular biology #E7023 (Lot #SHBJ8384), was from Sigma-Aldrich (St Louis, MO, USA).

Dunlop R.A., Banack S.A, & Cox P.A. (2021). A comparison of the efficiency of RNA extraction from extracellular vesicles using the Qiagen RNeasy MinElute versus Enzymax LLC RNA Tini Spin columns and qPCR of miRNA. Biology Methods & Protocols, 6(1), bpab015.

+ Open protocol

+ Expand

Exosomal RNA Isolation and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total exosomal RNA was isolated from 1.2 mL of serum using an exoRNeasy Midi Kit (77144, QIAGEN, Germany) according to the manufacturer’s instructions. Two hundred microliters of phosphate-buffered saline (PBS) was added to the membrane of a spin column to elute exosomes. Then, 50 μL of the eluate was used for nanoparticle tracking analysis (NTA), 50 μL of the eluate was used for transmission electron microscopy (TEM) analysis, and 100 μL of the eluate was used for Western blot analysis. Exosomes were isolated from the culture medium of PDAC cells that had been cultured in complete medium containing 10% exosome-depleted FBS for 48 h. Exosomal RNAs were extracted with an exoEasy Maxi Kit (76064, QIAGEN, Germany) following the manufacturer’s instructions.

Feng Z., Li K., Qin K., Liang J., Shi M., Ma Y., Zhao S., Liang H., Han D., Shen B., Peng C., Chen H, & Jiang L. (2022). RETRACTED ARTICLE: The LINC00623/NAT10 signaling axis promotes pancreatic cancer progression by remodeling ac4C modification of mRNA. Journal of Hematology & Oncology, 15, 112.

+ Open protocol

+ Expand

Quantitative Analysis of lncRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated from tissues and cell lines using TRIzol reagent (Invitrogen, CA, USA), and exosomal RNA was extracted from plasma and culture medium using the exoRNeasy Midi Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The cDNA was synthesized using a high capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania). Quantitative real-time PCR (qRT-PCR) was conducted with an ABI 7900 system (Applied Biosystems, CA, USA) and SYBR Green assays (TaKaRa Biotechnology, Dalian, China). We chose glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to normalize lncRNA expression levels. The fold change in the expression of lncRNA was calculated with the formula 2^-ΔCT. The primer sequences are shown in Additional file 1: Table S1.

Zheng R., Du M., Wang X., Xu W., Liang J., Wang W., Lv Q., Qin C., Chu H., Wang M., Yuan L., Qian J, & Zhang Z. (2018). Exosome–transmitted long non-coding RNA PTENP1 suppresses bladder cancer progression. Molecular Cancer, 17, 143.

+ Open protocol

+ Expand

Quantification of lncRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated from tissues and cell lines using TRIzol reagent (Invitrogen, CA, USA), and exosomal RNA was extracted from plasma and culture medium using the exoRNeasy Midi Kit (QIAGEN, Valencia, CA, USA), according to the manufacturer’s protocol.
The cDNA was synthesized using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania). Real-time qPCR was conducted with an ABI 7900 system (Applied Biosystems, CA, USA) and SYBR Green assays (TaKaRa Biotechnology, Dalian, China). We chose glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to normalize lncRNA expression levels. The fold change in the expression of lncRNA was calculated with the formula 2 − ΔCT. The sequences of the primers were as follows: SPRY4-IT1 forward, 5′-AGCCACATAAATTCAGCAGA-3′, reverse, 5′-CGATGTAGTAGGATTCCTTTCA-3′; and GAPDH forward, 5′-GACTCATGACCACAGTCCATGC-3′, reverse, 5′-AGAGGCAGGGATGATGTTCTG-3′. An ABI 7500 was used to carry out the qPCR and data collections.

Cao S., Lin L., Xia X, & Wu H. (2019). lncRNA SPRY4-IT1 Regulates Cell Proliferation and Migration by Sponging miR-101-3p and Regulating AMPK Expression in Gastric Cancer. Molecular Therapy. Nucleic Acids, 17, 455-464.

+ Open protocol

+ Expand

Exosome and miRNA Extraction from ADSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

ADSCs were cultured in DMEM containing 10% exosomes-free FBS (180625; SBI) for 48 h. The medium was then collected and centrifuged at 3000 × g for 10 min at 4°C. The supernatant was collected, transferred to a new tube, and placed on ice. Exosomes and miRNAs were extracted using an exoRNeasy Midi Kit (77144; QIAGEN), according to the manufacturer's protocol.

Yang J., Wang B., Wang Y., Feng C., Chen L., Liu Y., Chen X, & Dong P. (2022). Exosomes Derived from Adipose Mesenchymal Stem Cells Carrying miRNA-22-3p Promote Schwann Cells Proliferation and Migration through Downregulation of PTEN. Disease Markers, 2022, 7071877.

+ Open protocol

+ Expand

Exosomal RNA Extraction and lncRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The separation of total RNAs from tissues and cell lines was achieved by using TRIzol reagent (Invitrogen, CA, USA). ExoRNeasy Midi Kit (Qiagen, Valencia, CA, USA) was utilized for exosomal RNA extraction from plasma and culture medium according to the manufacturer’s instructions. cDNA synthesis was performed using a high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, Vilnius, Lithuania). Subsequently, an ABI 7900 system (Applied Biosystems, CA, USA) and SYBR Green assays (TaKaRa Biotechnology, Dalian, China) were adopted for qRT-PCR. LncRNA expression level was normalized with GAPDH as internal control, and 2^−ΔCt method was adopted to assess the fold change in lncRNA expression. The primer sequences used were as follows: SENP3-EIF4A1: F 5′ CCGCCAGTTCTACATCAACG 3′, R 5′ TTCCTCCGGGTGTTGATGAA 3′, GAPDH: F 5′ CCGGGAAACTGTGGCGTGATGG 3′, R 5′ AGG TGGAGGAGTGGGTGTCGCTGTT 3′, ZFP36: F 5′ GACTGAGCTATGTCGGACCTT 3′, R 5′ GAGT TCCGTCTTGTATTTGGGG 3′.

Wang J., Pu J., Zhang Y., Yao T., Luo Z., Li W., Xu G., Liu J., Wei W, & Deng Y. (2020). Exosome-transmitted long non-coding RNA SENP3-EIF4A1 suppresses the progression of hepatocellular carcinoma. Aging (Albany NY), 12(12), 11550-11567.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!