Iq thermal cycler

Total RNA was isolated using the PureZOL^TM RNA Isolation Reagent (Bio-Rad Laboratories, Inc. Hercules, Hercules, CA, USA) according to the manufacturer’s instructions and quantified through spectrophotometry (NanoDrop 2000, Thermo Scientific, Waltham, MA, USA). cDNA was synthesized using the iScript^TM cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) according to the supplier’s instructions, and was amplified using iQ^TM SYBR Green Supermix Kit (Bio-Rad) on iQ Thermal Cycler (Bio-Rad), according to the following program: initial denaturing step at 95.0 °C for 3 min; 40 cycles at 94.0 °C for 20 s; 54.0 °C for 30 s and 72.0 °C for 30 s. The primers, used at a final concentration of 10 μM, were: PLK1: forward 5′-CCCCTCACAGTCCTCAATAA-3′ and reverse 5′-TGTCCGAATAGTCCACCC-3′; GAPDH: forward 5′-ACAGTCAGCCGCATCTTC-3′ and reverse 5′- GCCCAATACGACCAAATCC-3′; Actin: forward 5′-AATCTGGCACCACACCTTCTA-3′ and reverse 5′-ATAGCACAGCCTGGATAGCAA-3′. Experiments were performed in triplicate, and the data were acquired using CFX ManagerTM Software (version 1.0, Bio-Rad). The results were analyzed according to ΔCT and normalized against Actin and GAPDH expression levels, which were used as control templates. A fold value of mRNA level ≥ or ≤1.5 relative to that of normal cells was considered as over- or underexpression, respectively.

Activation of the Notch pathway by the µCP ink was verified with qPCR. Culture plates with 2.5*10⁴ cells/cm² were subjected to different conditions; mimicking the experimental setup µCP ink coated with gelatin and topped with HUVECs in Matrigel enriched media, a control condition where Dll4 was not attached to the beads, and a control where no µCP ink was present. Additionally all conditions were subdued to the Notch signalling inhibitor DAPT (2.5 mg/ml in media, DMSO as vehicle), and its vehicle DMSO as well. After 24 h at 37 °C, 5% CO₂ RNA was isolated using RNeasy mini kit (Qiagen) according to manufacturer’s instructions. RNA was stored at −30 °C before cDNA synthesis. 200ng RNA per sample was used to synthesize cDNA. cDNA (1ng/µl, 2.5 µl volumes) was amplified using primers for FLT1 (VEGFR1) (Forward (Fw): CAAATAAGCACACCACGCCC, Reverse (Rv); CGCCTTACGGAAGCTCTCTT) KDR (VEGFR2) (Fw: CGGTCAACAAAGTCGGGAGA, Rv: CAGTGCACCACAAAGACACG), FLT4 (VEGFR3) (Fw: TGAGAGACGGCACAAGGATG, Rv: CTCCACCAGCTCCGAGAATG), EFNB2 (Fw: CTGCTGGGGTGTTTTGATGG, Rv: GTACCAGTCCTTGTCCAGGTAG), and references genes B2M and ACTB (Primerdesign) using the iQ Thermal cycler (BioRad). iQ SYBR Green (BioRad) was used as fluorescent dye. The number of experimental repetitions was 3 and the PCR was performed 3 times in total.

ChIP‐qPCR was performed as described previously (Boyer et al, 2005; Zhang et al, 2017). Briefly, after the treatment with DMSO, JQ1 (2 μM), CPI‐637 (2 μM), the combination of JQ1 (2 μM) and CPI‐637 (2 μM) or NEO2734 (2 μM), DU145 or C4‐2 cells were harvested for ChIP with BRD4 or Ac‐H3 antibodies. The DNAs pulled down by antibodies or non‐specific IgG were amplified by qPCR. The values were normalized to the individual input. Total RNAs were extracted with TRIzol (Invitrogen). Two micrograms of RNA was used for cDNA synthesis with SuperScript III First‐Strand Synthesis System (Promega). Quantitative PCR (qPCR) was carried out in the iQ thermal cycler (Bio‐Rad) using the iQ SYBR Green Supermix (Bio‐Rad). Each sample was used in triplicate, and three biological repeats were performed. The ΔCT was calculated by normalizing the threshold difference of a certain gene with glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH). The primer sequences are listed in Appendix Table S1.