Maxima sybr green rox qpcr master mix reagents

CYP1A2, CYP2B6 and CYP3A4 qPCR was performed according to manufacturer’s protocols by using TaqMan Universal PCR Master Mix (Applied Biosystems) and FAM-MGB Taqman probes directed against CYP1A2 (Thermo Fisher #Hs00167927), CYP2B6 (Thermo Fisher #Hs03044634), CYP3A4 (Thermo Fisher #Hs00604506) and HPRT1 (Thermo Fisher #Hs02800695) as a loading control. HNF4a, Vimentin and RPLP0 qPCR was performed by using Maxima SYBR Green/ROX qPCR Master Mix reagents (Thermo Fisher Scientific) with the following primers: HNF4a forw TGGTGGACAAAGACAAGAGGAAC, rev GAGCGCATTGATGGAGGGCA, Vimentin forw GACCAGCTAACCAACGACAAAG, rev GGTGTTTTCGGCTTCCTCTCT and RPLP0 forw CTGGAGGGTGTCCGCAATGT, rev AGCAGCCACAAAGGCAGATGGAT. All qPCR reactions were carried out with a LightCycler^® 480 Instrument II (Roche) and the data acquired were analysed with LightCycler^® 480 Software (Roche). The results were calculated by using the ΔΔCT method against HPRT1 or RPLP0 as a loading control. The qPCR reactions were performed at least 3 times for each sample.

Total RNA was reverse transcribed with a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific) according to manufacturer’s instructions. qPCR was performed using Maxima SYBR Green/ROX qPCR Master Mix reagents (Thermo Fisher Scientific) with following primers: SOX-11-fw, 5′ GGAGAGCTTGGAAGCGGAGA 3′ and SOX-11-rev 5′ CAAGCCATGAATTCGCCCTC 3′, HPRT1-fw 5′ CCCTGGCGTCGTGATTAGTG 3′ and HPRT1 -rev 5′ GTGATGGCCTCCCATCTCCT 3′. All qPCR reactions were carried out with a LightCycler^® 480 Instrument II (Roche) and the data acquired were analyzed with LightCycler^® 480 Software (Roche). Target genes mRNA expression was normalized to endogenous mRNA level of the housekeeping reference gene HPRT1. The qPCR reactions were performed at least 3 times for each sample.