The expression level of the target genes in this study was determined by real-time polymerase chain reaction (RT-PCR). Total RNA from the cells of different treatment groups was extracted using the YTA total RNA purification mini kit (Yekta Tajhiz Azma, Iran) and according to the manufacturer’s protocol. After treatment with DNase I to remove genomic DNA, cDNA was reverse transcribed using RevertAid™ first-strand cDNA synthesis kit (Fermentas, USA). Maxima SYBR Green ROX qPCR master mix kit (Fermentas) was used according to the manufacturer’s protocol in an ABI StepOnePlus™ RT-PCR system (Applied Biosystems, USA). The cycling parameters were as follows: 10 min at 95 °C for the initial denaturation followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/extension for 1 min at 60 °C. β-Actin was used as a reference gene for internal control. The data were analyzed using the comparative Ct (ΔΔCt) method (25 (link)). The experiments were carried out in triplicate and were independently repeated at least three times. Gene-specific primer sequences are presented in Table 1 .
Yta total rna purification mini kit
Manufactured by Yekta Tajhiz Azma
The YTA Total RNA Purification Mini kit is a laboratory equipment designed to extract and purify total RNA from various biological samples. The kit utilizes a silica-membrane-based technology to efficiently capture and elute high-quality RNA for downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Maxima sybr green rox qpcr master mix kit, by Thermo Fisher Scientific (2 mentions)
Abi steponeplus rt pcr system, by Thermo Fisher Scientific (1 mentions)
Realq plus 2x master mix green, by Ampliqon (1 mentions)
Abi steponeplus real time pcr system, by Thermo Fisher Scientific (1 mentions)
3 protocols using yta total rna purification mini kit
1
Quantifying Gene Expression by RT-PCR
2
Quantifying Foxp3 Expression via SYBR Green qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells according to the YTA Total RNA Purification Mini kit (Yekta Tajhiz Azma, Iran) and was reversed transcribed using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. Quantitative expression levels of Foxp3 and the reference gene (Mouse β-actin) were evaluated via SYBR Green I real-time PCR. Briefly, after synthesizing cDNA, real-time PCR was performed on Rotor_Gene6000 system (QIAGEN,Germany) using RealQ Plus 2x Master Mix Green (Ampliqon, Denmark) according to manufacturer’s protocols.
Each reaction contained 10 μL of 2x Master Mix, 0.5 μL of each specific primer( 10 pm/ l) , and 1 μL (5 ngr) of the cDNA, to a total volume of 20 μL. Reaction using the following thermal profile: 15 min at 95 ◦C, followed by 40 cycles of 20 s at 95 ◦C and 1 min at 58 ◦C. The primers used in PCR reactions were as follows: Foxp3 forward (5′-GGCCCTTCTCCAGGACAG-3′), Foxp3 reverse (5′- GCTGATCATGGCTGGGTTG -3′), and β-actin forward (5′-CTTCTTGGGTATGGAATCCTG-3′), β-actin reverse (5′- GTGTTGGCATAGAGGTCTTTAC -3′).
Each reaction contained 10 μL of 2x Master Mix, 0.5 μL of each specific primer
3
Gene Expression Analysis by RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression level of the genes of interest in this study was determined by real-time polymerase chain reaction (RT-PCR). Total RNA from the cells of different treatment groups was extracted using the YTA Total RNA Purification Mini kit (Yekta Tajhiz Azma, I.R. Iran) according to the manufacturer protocol. After treatment with DNase I to remove genomic DNA, cDNA was reverse transcript using Revert Aid ™ First Strand cDNA Synthesis Kit (Fermentas, USA).
Maxima SYBR Green ROX qPCR Master Mix kit (Fermentas, USA) used according to the manufacturer’s protocol in an ABI Step One Plus™ Real-Time PCR System (Applied Biosystems, USA). The cycling parameters were as follows: 10 min at 95 °C for initial denaturation, followed by 40 cycles of denaturation step at 95 °C for 15 s and annealing/extension for 1 min at 60 °C. β-actin (ACTB) was used as a reference gene for internal control. Data were analyzed by the comparative Ct (ΔΔct) method. These experiments were carried out in triplicate and were independently repeated at least 3 times (26 (link)). Gene-specific primer sequences are presented inTable 1 .
Maxima SYBR Green ROX qPCR Master Mix kit (Fermentas, USA) used according to the manufacturer’s protocol in an ABI Step One Plus™ Real-Time PCR System (Applied Biosystems, USA). The cycling parameters were as follows: 10 min at 95 °C for initial denaturation, followed by 40 cycles of denaturation step at 95 °C for 15 s and annealing/extension for 1 min at 60 °C. β-actin (ACTB) was used as a reference gene for internal control. Data were analyzed by the comparative Ct (ΔΔct) method. These experiments were carried out in triplicate and were independently repeated at least 3 times (26 (link)). Gene-specific primer sequences are presented in
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!