Taqman snp probe

Genomic DNA was isolated from peripheral blood using the QIAmp DNA Mini Kit (QIAGEN, Germany), following the manufacturer’s instructions. DNA (10 ng) was analysed with NanoDrop and was mixed with Taqman genotyping master mix (Thermo Fisher Scientific, Applied Biosystems, Sweden) and was amplified using the 7500 Fast Real-Time PCR system (Applied Biosystems). Genotypes of SNPs rs2228262 (# C__16170900_10) and rs1478604 (# C___3100547_20) were analysed with the 7500 Fast Real-Time PCR system with allelic discrimination using TaqMan SNP probes (Applied Biosystems) according to a previous protocol [10 (link)]. The two SNPs, belonging to two different haploblocks, one in the 5’UTR and one in one of the exons, were selected from relevant results in the literature. Amplification was performed using an initial cycle at 50 °C for two minutes, followed by one cycle at 95 °C for 10 min, and finally 40 cycles at 95 °C for 15 s and at 60 °C for one minute. Internal controls and negative controls were included in all PCRs. The manual calling option in the allelic discrimination application ABI PRISM 7500 SDS software, version 1.3.1 (Applied Biosystems) was used to assign genotypes. A total call rate of 98.5% was achieved.

DNA was extracted from 8 mL of whole blood using a PAXgene^TM Blood DNA Kit (PreAnalytiX GmbH, Hombrechtikon, Switzerland). Genomic DNA was quantified using a NanoPhotometer™ P300 (Implen, Westlake Village, CA, USA) and diluted to a concentration at 25 µg/mL with sterilized double distilled water. A predesigned TaqMan^® SNP probe for the LP genotype (Assay ID: C_2104745_10; SNP ID: rs4988235) was purchased from ThermoFisher Scientific (Carlsbad, CA, USA). The context DNA sequence for the SNP probe is GAGGAGAGTTCCTTTGAGGCCAGGG[A/G]CTACATTATCTTATCTGTATTGCCA, where [A/G] is the transition substitution. TaqMan genotyping reactions were performed using a TaqMan SNP assay-based polymerase chain reaction (PCR) (ThermoFisher Scientific) in an Applied Biosystems™ QuantStudio™ 7 Flex Real-Time PCR System according to the manufacturer’s instructions. Fifty ng of genomic DNA was added into each PCR reaction along with 0.25 µL of the TaqMan SNP probe, 5 µL of 2× TaqMan Genotyping Master Mix, and 2.75 µL of sterilized double distilled water. Allelic discrimination assays were performed using QuantStudio™ Real-Time PCR software (ThermoFisher Scientific). All the ambiguous genotypes were repeated in independent PCR reactions.