For every reaction, 5 µl Dynabeads MyOne Streptavidin T1 (Invitrogen, 65602) were washed twice with 1.45 µl washing solution containing 100 mM NaOH (Sigma-Aldrich, S8045-500G), 50 mM NaCl (Ambion, AM9760G), and UltraPure DNase/RNase-Free Distilled Water (Invitrogen, 10977035). The beads were then washed with 1.45 µl RNAse-free bind and wash solution containing 0.01 mM Tris (Invitrogen, AM9855G), 1 mM EDTA (AM9260G), 2 M NaCl (Ambion, AM9760G), and UltraPure DNase/RNase-Free Distilled Water (Invitrogen, 10977035). The beads were then mixed with 2 µl RNAse-free bind and wash solution and 0.1 µl oligo-dT (IDT, 5′-/5BiotinTEG/AAGCAGTGGTATCAACGCAGAGTA CT30VN-3′) and incubated in ambient temperature for 15 min. The beads were finally stored in 1 µl 1% BSA (Ambion, AM2616) in TE buffer (Invitrogen, AM9858) and incubated on a rotator overnight at 8 °C. Before use, the buffer was exchanged with RNA and Protein lysis buffer.
Am9760g
Manufactured by Thermo Fisher Scientific
The AM9760G is a high-performance laboratory centrifuge designed for a variety of scientific applications. It features a compact and durable design, with a maximum speed of 17,500 RPM and a maximum capacity of 6 x 85 mL. The centrifuge is equipped with an efficient brushless motor and offers programmable speed and time controls for precise sample processing. It is suitable for use in various laboratory settings, including research, clinical, and industrial environments.
Automatically generated - may contain errors
Lab products found in correlation
Am9260g, by Thermo Fisher Scientific (3 mentions)
Tris edta buffer, by Merck Group (1 mentions)
Hiseq x ten pe150 platform, by Illumina (1 mentions)
Fc 121 1030, by Illumina (1 mentions)
Minelute pcr purification kit, by Qiagen (1 mentions)
Am9260g, by Merck Group (1 mentions)
Dynabeads myone streptavidin t1, by Thermo Fisher Scientific (1 mentions)
Am9858, by Thermo Fisher Scientific (1 mentions)
Am2616, by Thermo Fisher Scientific (1 mentions)
Ultrapure dnase rnase free distilled water, by Thermo Fisher Scientific (1 mentions)
5 protocols using am9760g
1
Oligo-dT Magnetic Bead Preparation
2
Tn5 Transposome Complex Formation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To begin with the complex formation, each of Mosaic end-adapter A (Tn5ME-A, TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG) and Mosaic end-adapter B (Tn5ME-B, GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) oligonucleotides were annealed with Mosaic-end reverse oligonucleotides (Tn5MErev, 5′-[phos]CTGTCTCTTATACACATCT-3′). To anneal, the oligonucleotides were diluted to 100μM. Each pair of oligos, Tn5MErev/Tn5ME-A and Tn5MErev/Tn5ME-B, was mixed separately resulting in 50μM annealed products respectively. The product was denatured in a thermocycler for 5 min at 95°C and then cooled down slowly at ramp rate 0.1 degree celsius per second in thermocycler. The loading of pA-Tn5 with the oligonucleotides was carried out by incubating 2ul 50uM Tn5MErev/Tn5ME-A, 2ul 50uM Tn5MErev/Tn5ME-B, 21.56ul Glycerol, 21.3ul 2X Dialysis buffer (100 mM HEPES-KOH pH 7.2, 0.2 M NaCl (Thermo Fisher Scientific, AM9760G), 0.2 mM EDTA (Thermo Fisher Scientific, AM9260G), 2 mM DTT, 0.2% Triton X-100 (Thermo Fisher Scientific, 85111) and 20% Glycerol), 3.14ul pA-Tn5 (63.64uM (3.5 mg/ml)), for 1h at room temperature (the final concentration is 2uM). The enzyme was stored at -20°C until further use, or at -80 for long term storage.
3
MicroRNA Sensing on Diamond Surfaces
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stock solution of 5 mM of MnCl2 and 10 mM of NaCl was prepared by dissolving manganese (II) chloride tetrahydrate (CAS: 13446-34-9, Merck) and diluting 5 M NaCl buffer (AM9760G, Thermo Fisher Scientific) in ribonucleases free, DEPC-treated water (CAS: 7732-18-5, Thermo Fisher Scientific). This stock solution was then split into two parts. One part was used for control measurements and the other part was used to prepare microRNA solutions. Single-stranded miR-21 (sequence: 5′-UAGCUUAUCAGACUGAUGUUGA-3′) with no additional end or internal chemical modifications were purchased from Biomers.net GmbH in a dried state. MiR-21 was then dissolved in 5 mM MnCl2 and 10 mM NaCl stock solution to obtain 1 μM and other concentration microRNA solutions. Tris-EDTA buffer solution (SKU: 93283-500 ML, Merck) was used to flush diamond surface prior to sensitivity measurements. To investigate dependence of the diamond surface charge state on the pH of the solution we split 5 mM MnCl2 stock solution into four parts. The pH values for the three solutions were lowered down to 4, 3, and 2 using 1 M hydrochloric acid (HCl) solution while pH of the fourth solution was not adjusted.
4
Tn5 Transposome Complex Formation
5
Multiplex Tissue Nuclei Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Approximately 5 mg of tissue from each of the skeletal muscle, spleen, heart, liver, and fat samples was crushed into a fine powder in liquid nitrogen (Supplementary Table 1 ). Pulverized tissues were suspended in 1 mL ice-cold PBS and then gently spun down. The cell pellet was resuspended in 1 mL lysis buffer (50 mM HEPES with pH 7.5 [Life technologies, 15630-080], 140 mM NaCl [Ambion, AM9760G], 1 mM EDTA with pH 8.0 [Ambion, AM9260G], 10% glycerol [Sigma-Aldrich, G7757], 0.5% NP-40 [Roche, 11754599001], and 0.25% Triton X-100 [Amresco, 0694]), followed by isolation of 50,000 nuclei using a previously published protocol with minor modifications79 . Then, the transposition reaction mix (12.5 μL TD buffer, 10 μL ddH2O, and 2.5 μL TDE [Illumina, FC-121-1030]) was added to the isolated nuclei. The reaction system was incubated at 37 °C for 1 h followed immediately by purification with a QIAGEN MinElute PCR Purification Kit (QIAGEN, 28006). The transposed DNA fragments were amplified with the appropriate number of cycles as determined by qPCR. Size selection of the amplified PCR products (100–600 bp fragments) was performed by gel-purification informing previously studies79 –81 (link). Products from the size selection step were quantified and sequenced using an Illumina HiSeq X Ten PE150 platform.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!