Log In Sign up
The largest database of trusted experimental protocols

Phase lock gel tubes

Manufactured by Avantor
Visit Supplier

Phase Lock Gel tubes are laboratory containers designed to facilitate the separation and isolation of specific components from complex mixtures during sample preparation. The core function of these tubes is to create a physical barrier that effectively traps and isolates the desired analyte, allowing for efficient extraction and purification.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (6 mentions) Turbo dnase, by Thermo Fisher Scientific (3 mentions) Lightcycler 480 instrument, by Roche (3 mentions) Rnaseout recombinant ribonuclease inhibitor, by Thermo Fisher Scientific (2 mentions) Colorless gotaq reaction buffer, by Promega (2 mentions) Sybr green with gotaq dna polymerase, by Promega (2 mentions) Superscript 2, by Thermo Fisher Scientific (2 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Clean and concentrator 5 kit, by Zymo Research (1 mentions) Hiseq 2500, by Illumina (1 mentions) Random hexamer primer, by Thermo Fisher Scientific (1 mentions) M mlv, by Thermo Fisher Scientific (1 mentions) Ssiii reverse transcriptase, by Thermo Fisher Scientific (1 mentions)

Close spelling variants of this product

Phase Lock Gel Heavy tubes (3 citations)

4 protocols using phase lock gel tubes

1

cDNA Generation and qPCR Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate cDNA, total RNA was isolated from frozen cell samples using TRIzol® reagent (ThermoFisher Scientific) and Phase Lock Gel tubes (VWR), treated with Turbo DNase (Thermo Fischer Scientific), and reverse-transcribed using SuperScript® II or SuperScript® III Reverse Transcriptase (ThermoFisher Scientific) with oligo(dT) primers in the presence or absence of RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific). Quantitative PCR (qPCR) reactions by adding 20 μL master mix containing 1.1X Colorless GoTaq® Reaction Buffer (Promega), 0.7 mM MgCl2, dNTPs (0.2 mM each), primers (0.75 μM each), and 0.1X SYBR Green with GoTaq® DNA polymerase (Promega) to 2 μL cDNA, mock-RT samples, or water in 22 μL reactions. Reactions were run on a LightCycler® 480 Instrument (Roche). Experiments were performed in technical triplicates. RT-qPCR primers used were against ACTB (oBA74: GCTACGAGCTGCCTGACG, oBA75: GGCTGGAAGAGTGCCTCA), KIF2C (oMYC032: CAACTCCAAAATTCCTGCTCC, oMYC033: GAACTGAAAACTGCTTGCGG), TACC3 (oMYC038: ACAGACGCACAGGATTCTAAG, oMYC039: GTTTTGGCATCCACTTCCTTG).
Jost M., Chen Y., Gilbert L.A., Horlbeck M.A., Krenning L., Menchon G., Rai A., Cho M.Y., Stern J.J., Prota A.E., Kampmann M., Akhmanova A., Steinmetz M.O., Tanenbaum M.E, & Weissman J.S. (2017). Combined CRISPRi/a-Based Chemical Genetic Screens Reveal that Rigosertib Is a Microtubule-Destabilizing Agent. Molecular Cell, 68(1), 210-223.e6.
+ Open protocol
+ Expand
2

cDNA Synthesis and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate cDNA, total RNA was isolated from frozen cell samples using TRIzol reagent (Thermo Fisher Scientific) and Phase Lock Gel tubes (VWR), treated with Turbo DNase (Thermo Fisher Scientific), and reverse-transcribed using SuperScript II or SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with oligo(dT) primers in the presence or absence of RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific). Quantitative PCR (qPCR) reactions by adding 20 μL master mix containing 1.1X Colorless GoTaq Reaction Buffer (Promega), 0.7 mM MgCl2, dNTPs (0.2 mM each), primers (0.75 μM each), and 0.1X SYBR Green with GoTaq DNA polymerase (Promega) to 2 μL cDNA, mock-RT samples, or water in 22 μL reactions. Reactions were run on a LightCycler 480 Instrument (Roche). Experiments were performed in technical triplicates. RT-qPCR primers used were against ACTB (oBA74: GCTACGAGCTGCCTGACG, oBA75: GGCTGGAAGAGTGCCTCA), KIF2C (oMYC032: CAACTCCAAAATTCCTGCTCC, oMYC033: GAACTGAAAACTGCTTGCGG), TACC3 (oMYC038: ACAGACGCACAGGATTCTAAG, oMYC039: GTTTTGGCATCCACTTCCTTG).
Jost M., Chen Y., Gilbert L.A., Horlbeck M.A., Krenning L., Menchon G., Rai A., Cho M.Y., Stern J.J., Prota A.E., Kampmann M., Akhmanova A., Steinmetz M.O., Tanenbaum M.E, & Weissman J.S. (2017). Combined CRISPRi/a-Based Chemical Genetic Screens Reveal that Rigosertib Is a Microtubule-Destabilizing Agent. Molecular Cell, 68(1), 210-223.e6.
+ Open protocol
+ Expand
3

Transcriptome Analysis of Male Drosophila Abdomens

Check if the same lab product or an alternative is used in the 5 most similar protocols
For each of the 42 samples, total RNA was extracted from 10 eviscerated abdomens using a phenol-chloroform extraction followed by ethanol precipitation. A total of 420 male flies were dissected on an ice-cold dissection block removing the head, thorax and loose components of the abdomen. The eviscerated abdomens were then placed in chilled TRIzol and homogenized at 30hz for 4 min in a TissueLyser®. Total RNA was extracted from cell lysates with chloroform using phase lock gel tubes (VWR, Rednor, PA) followed by alcohol precipitation and resuspension in molecular biology grade water. DNA was removed using a Turbo DNA free kit and a final cleanup was done using a Zymo clean and concentrator-5 kit. Concentration and contamination was assessed by nanodrop analysis with additional quality control steps performed by Genewiz, Inc. (South Plainfield, NJ). Transcriptome sequencing was done by Genewiz using an Illumina HiSeq2500 at 6 samples per lane with 50 base pair single end reads.
Santiago J.C., Boylan J.M., Lemieux F.A., Gruppuso P.A., Sanders J.A, & Rand D.M. (2021). Mitochondrial genotype alters the impact of rapamycin on the transcriptional response to nutrients in Drosophila. BMC Genomics, 22, 213.
+ Open protocol
+ Expand
4

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from frozen cell samples using TRIzol reagent (Thermo Fisher Scientific) and Phase Lock Gel tubes (VWR), treated with Turbo DNase (Thermo Fisher Scientific), or using Direct-zol RNA MiniPrep kit. Reverse-transcription was carried using M-MLV (Thermo Fisher Scientific) or SSIII Reverse-transcriptase (Thermo Fisher Scientific) with random hexamer primers (Thermo Fisher Scientific, SO124) in the presence of RNaseIN Recombinant Ribonuclease Inhibitor (Thermo Fisher Scientific). Quantitative PCR (qPCR) was performed with Kappa Sybr Fast qPCR 2x Mix (Roche), according to the manufacturer’s instructions on a LightCycler 480 Instrument (Roche). Experiments were performed in technical triplicates. RT-qPCR primers used are listed in (Table S3).
Hickey K.L., Dickson K., Cogan J.Z., Replogle J.M., Schoof M., D’Orazio K.N., Sinha N.K., Hussmann J.A., Jost M., Frost A., Green R., Weissman J.S, & Kostova K.K. (2020). GIGYF2 and 4EHP Inhibit Translation Initiation of Defective Messenger RNAs to Assist Ribosome-Associated Quality Control. Molecular cell, 79(6), 950-962.e6.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!