Gapdh primer

Total RNA was extracted from the samples in each group using RNA extraction reagents (Nanjing Novizan Medical Technology Co., Ltd.), following the manufacturer's instructions. RNA was quantified using a spectrophotometer and then reverse transcribed into cDNA using PrimeScript™ RT Master Mix kit (cat. no. RR036A, Takara Biotechnology Co., Ltd.). qPCR was performed using PrimeSTAR^® Max DNA Polymerase (Takara Biotechnology Co., Ltd.) on an RT-PCR system (Agilent Technologies, Inc.). The samples were amplified using the following thermocycling conditions: Initial denaturation at 95°C for 30 sec; followed by 40 cycles of denaturation at 95°C for 5 sec, annealing at 55°C for 30 sec and elongation at 72°C for 30 sec; and a final extension at 72°C for 10 min. The relative mRNA expression levels of the target genes were calculated as the fold change of the control using the 2^−ΔΔCq method (25 (link)). GAPDH primers, obtained from Sangon Biotech (Shanghai) Co., Ltd., were used as the internal reference. The forward and reverse primers used are listed in Table I.

The cells were seeded at 1 × 10⁵ cells/well into 6-well plates, and the medium was changed as described above. After 7 days, RNA was extracted by using TRIzol (Ambion, Austin, TX, USA) and a small total RNA extraction kit (Tianmobio, Beijing, China). HiScript Ⅱ Q RT SuperMix (Vazyme, Nanjing, China) and ChamQ Universal SYBR qPCR Master Mix (Vazyme) were used for reverse transcription PCR and real-time qPCR. All steps were performed according to the manufacturer's instructions. The sequences of the primers used are listed in Table 1. Endogenous reference gene (GAPDH) primers were purchased from Sangon Biotech (Shanghai, China), which also synthesized the other primers. Reverse transcription PCR was performed using Biometra TOne (Analytik Jena, Jena, Germany). Real-time qPCR was performed using an Applied Biosystems QuantStudio instrument (Thermo Fisher Scientific). Relative quantification was calculated using 2^-ΔΔCt.Table 1

Primer sequences.

Table 1

Gene name	Primer sequence (5′ -3′)	Product size (bp)	Transcript ID
SPP1	F CTCCATTGACTCGAACGACTCR CAGGTCTGCGAAACTTCTTAGAT	230	NM_001,251,830
POSTN	F CTCATAGTCGTATCAGGGGTCGR ACACAGTCGTTTTCTGTCCAC	138	NM_001,135,935
COL-Ⅰ	F GAGGGCCAAGACGAAGACATCR CAGATCACGTCATCGCACAAC	140	NM_000088

Total RNA was extracted from left ventricle tissue samples using TRIzol reagent, according to the manufacturer's instructions. The concentration and purity of isolated RNA was subsequently detected. cDNA was generated from 1 µg total RNA using a high-capacity cDNA reverse transcription kit (4368814; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. Reverse transcription was performed as follows: 25°C for 10 min, 37°C for 2 h, 85°C for 5 min and stored at 4°C. GAPDH primers were purchased from Sangon Biotech Co., Ltd. (Shanghai, China) and all other primers were synthesized and purified by Sangon Biotech Co., Ltd., as listed in Table I. cDNA was quantified using a QuantiFast SYBR Green PCR kit and qPCR was performed using a 7500 Fast Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). Briefly, the amplification was performed with an initial step at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 10 sec, annealing at 60°C for 30 sec and extension at 60°C for 30 sec for each target gene. All amplification reactions for each sample were performed in triplicate and the results were expressed as the ratio of target genes to GAPDH mRNA using the 2^−ΔΔCq method (24 (link)).

Using TRIzol reagent (9108, Takara, Japan), total RNA was extracted from the bladder and L6-S1 DRG. After determining the RNA concentration and purity by using a spectrophotometer (Micro Drop, Bio-DL, USA), the RNA was reverse transcribed into cDNA using reverse transcription reagent (RR047A, Takara, Japan). Finally, real-time PCR analysis was performed on a real-time PCR instrument (4376600, Thermo Fisher, USA) using fluorescent reagent (208054, QIAGEN, Germany). The primer sequences were as follows: GPR18: 5ʹ-CATCTCAGCAACCCTCCAAC-3ʹ and 5ʹ-CCATGGTACGTAGAAACTCCTG-3ʹ; TRPV1: 5ʹ-CTCCAAGGCACTTGCTCCAT-3ʹ and 5ʹ-GTGGCTTGCAGTTAGGGTCT-3ʹ. A GAPDH primer was purchased from Sangon Biotech (B661204, China).