To quantify the endogenous expression levels of miRNA199a, total RNA was isolated with TRIzol, and cDNA was synthesized with the MystiCq microRNA cDNA Synthesis Mix (Sigma Aldrich, St. Louis, MO, USA) as per the manufacturer’s protocol. The synthesized cDNA was then used for real-time qPCR with the Bioline SYBR Lo-ROX system (Alexandria, Australia) in a ViiA7 RT-PCR machine (Thermo Fisher Scientific) in the following conditions: 95°C for 10 min followed by 40 cycles of 95°C for 5 s, 60°C for10 s, and 70°C for10 s. The MystiCq Universal PCR (MIRUP, Sigma) and 5′-CCCAGTGTTCAGACTACCTG-3′ primers were used to amplify miRNA199a, and the amount of miR199a was calculated as the number of copies per 1,000 copies of RNU6 (MIRCP00001) control using the formula 2ˆ(Ct control − Ct sample) ⋅ 1,000. A 100% homologous nature of murine and human miRNA199a allowed usage of the same primer for amplification. Similarly, markers for the level of stemness (CD44, CD133, and Oct4) were measured relative to GAPDH control (primers are listed in Table S1 ).
Viia7 rt pcr machine
Manufactured by Thermo Fisher Scientific
Sourced in Australia
The ViiA7 RT-PCR machine is a real-time PCR system designed for gene expression analysis and quantitative PCR applications. It features a 96-well block format and supports various fluorescent dyes and probes for sensitive and accurate detection of target sequences.
Automatically generated - may contain errors
Lab products found in correlation
Mysticq microrna cdna synthesis mix, by Merck Group (3 mentions)
Rneasy plus mini kit, by Qiagen (3 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (3 mentions)
Mysticq universal pcr mirup, by Merck Group (2 mentions)
Bioline lo rox sybr, by Meridian Bioscience (2 mentions)
Hygromycin, by Roche (2 mentions)
Taqman universal master mix, by Thermo Fisher Scientific (2 mentions)
Qiashredder column, by Qiagen (2 mentions)
Iscript kit, by Bio-Rad (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr green reagent, by Roche (1 mentions)
Iscript cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Powerup sybr green master mix kit, by Thermo Fisher Scientific (1 mentions)
Sybr green 1 nucleic acid gel stain, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Qiacube robot, by Qiagen (1 mentions)
Viia7 software v1, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
High capacity cdna reverse transcription kit with rnase inhibitor, by Thermo Fisher Scientific (1 mentions)
14 protocols using viia7 rt pcr machine
1
Quantifying miRNA199a and Stemness Markers
2
Quantification of Cellular miRNAs by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Endogenous levels of miRNAs were quantified by real time quantitative PCR (qRT-PCR). Total RNA was extracted from cells using trizol and cDNA was synthesized using the MystiCq microRNA cDNA Synthesis Mix (Sigma Aldrich, St. Louis, MO, USA). Next, Bioline Lo-Rox Sybr (Bioline, Australia) was used to perform qRT-PCR in the ViiA7 RT-PCR machine (Thermo Fisher Scientific) under the following conditions: 95 °C: 10 m followed by 40 cycles of 95 °C: 5 s, 60 °C:10 s and 70 °C: 10 s. Forward primer used for miRNA122a was 5′-TGGAGTGTGACAATGGTGTTTGT-3′ whereas that for miRNA199a was 5′-CCCAGTGTTCAGACTACCTG-3′. Both the miRNAs were expressed as number of copies per 1000 copies of the control microRNA RNU6-1 (MIRCP00001) using the formula (2^ (Ct (RNU6-1)-Ct (miRNA122a/199a)) *1000. MystiCq Universal PCR (MIRUP, Sigma) was used as a reverse primer for the qRT-PCR reactions.
3
Quantification of miRNA122a and Stemness Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Endogenous expression levels of miRNA122a was quantified by quantitative real time PCR (qRT-PCR) with Bioline Lo-Rox Sybr (Bioline, Alexandria, Australia) using the ViiA7 RT-PCR machine (Thermo Fisher Scientific) at following conditions: 95° C- 2mins followed by 40 cycles of 95° C- 5 s, 60° C -15 s and 70° C -15 s on the cDNA which was synthesized from total RNA isolated with trizol using the MystiCq microRNA cDNA Synthesis Mix (Sigma Aldrich) as per the manufacturer's recommendations. MystiCq Universal PCR (MIRUP, Sigma) and 5′- TGGAGTGTGACAATGGTGTTTGT- 3′ primers were used and the levels if miRNA122a was calculated as number of copies per 1000 copies of human positive control using formula (2^(Ct control-Ct sample))*1000. Similarly, HCC stemness markers CD44, EpCAM, and Oct4 were quantified as number of copies per 1000 copies of GAPDH housekeeping gene using primers listed in Table 1 .
4
Quantitative Gene Expression Analysis in CRC Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA of CRC cells was extracted using Trizol reagent (Invitrogen) according to the manufacturer’s protocol. cDNA was synthesized in a total volume of 20 ul using a cDNA reverse transcription reaction kit (TAKARA). RT-PCR was performed with a PrimeScript™ RT reagent Kit (TAKARA) using a Viia7 RT-PCR machine (Thermo Fisher Scientific). Primers for c-Myc were 5′-AAAGGCCCCCAAGGTAGTTA-3′ (forward), 5′-GCACAAGAGTTCCGTAGCTG-3′(reverse); for FASN: 5′-CTTCCGAGATTCCATCCTACGC-3′(forward), 5′-TGGCAGTCAGGCTCACAAACG-3′(reverse); for ACC1: 5′-GCTCCTTGTCACCTGCTTCT-3′(forward), 5′-AAGGCCAAGCCATCCTGTA- 3′(reverse); for CPT1: 5′-ATCAATCGGACTCTGGAAACGG-3′(forward), 5′-TCAGGGAGTAGCGCATGGT-3′(reverse); for MCAD: 5′-GGAAGCAGATACCCCAGGAAT-3′(forward), 5′-AGCTCCGTCACCAATTAAAACAT-3′(reverse); for GAPDH: 5′-TTGGTATCGTGGAAGGACTCA-3′(forward), 3′-TGTCATCATATTTGGCAGGTT- 5′(reverse). All the mRNA expressions were normalized to that of GAPDH.
5
Targeted Inducible Gene Expression in ESCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ESC lines were thawed into M15+LIF medium and cultured for 2 d prior to targeting. CHC targeting was performed as described previously (Dow et al. 2012 (link)). The Pdx1 ESC line was cultured in KOSR+2i medium (Gertsenstein et al. 2010 (link)) starting immediately after targeting and also throughout selection with hygromycin (Roche). The p48 ESC line was kept in M15+LIF and changed to KOSR+2i no earlier than 48 h prior to blastocyst injection.
Correct integration of the targeting vector into the CHC locus was confirmed by PCR as described previously (Dow et al. 2012 (link)). To rule out additional random integrations of the targeting vector in the genome, we performed a TaqMan copy number assay for GFP (Invitrogen) according to the manufacturer's instructions on a ViiA7 RT–PCR machine (Life Technologies). Functionally, ESC clones were tested by treatment with and without adenoviral Cre recombinase (University of Iowa) to activate the latent rtTA3 within the CAGs-LSL-RIK allele in the adenoviral Cre-treated ESCs and by subsequent addition of dox to the growth medium for 3 d, and GFP induction was detected by flow cytometry to determine activation of the targeted CHC locus.
Correct integration of the targeting vector into the CHC locus was confirmed by PCR as described previously (Dow et al. 2012 (link)). To rule out additional random integrations of the targeting vector in the genome, we performed a TaqMan copy number assay for GFP (Invitrogen) according to the manufacturer's instructions on a ViiA7 RT–PCR machine (Life Technologies). Functionally, ESC clones were tested by treatment with and without adenoviral Cre recombinase (University of Iowa) to activate the latent rtTA3 within the CAGs-LSL-RIK allele in the adenoviral Cre-treated ESCs and by subsequent addition of dox to the growth medium for 3 d, and GFP induction was detected by flow cytometry to determine activation of the targeted CHC locus.
6
Genetically Engineered Mouse ES Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
KC-RIK ES cells were cultured in M15 +LIF media and targeted as described previously (Dow et al., 2012 (link); Saborowski et al., 2014 (link)). Clones were selected with hygromycin (Roche) and subjected to functional testing and copy number validation. For functional testing, clones were treated cultured ±Cre expressing Adenovirus (University of Iowa) cultured for 3 days ± doxycycline. Clones that were GFP +as assessed by flow cytometry in the Cre +Dox condition were assessed for single integration into the CHC locus using the Taqman copy number assay for GFP (Life Technologies) on a ViiA7 RT–PCR machine (Life Technologies). Positive clones were expanded and switched to KOSR + 2I 2 days prior to blastocyst injection. The identity and genotype of the ES was authenticated by allele-specific PCRs, and normal genomic status was confirmed by high-resolution Comparative Genomic Hybridization (CGH) array, as previously described (Saborowski et al., 2014 (link)). ES were confirmed to be negative for mycoplasma and other microorganisms before injection.
7
Quantifying Cholesterol Pathway Genes
8
Quantifying Cardiac Gene Expression in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At 3, 5, and 7 dpf, zebrafish embryos were euthanized and hearts were isolated with forceps using a Leica M205C fluorescence stereomicroscope and placed in lysis buffer prior to RNA isolation. At least 10 hearts were pooled per sample and RNA was extracted using a RNeasy Plus Mini kit (Qiagen). cDNA synthesis was performed immediately following RNA isolation protocol using iScript cDNA synthesis kit (Invitrogen). Quantitative RT-PCR was performed using cDNA, Sybr Green reagent (Roche) and gene-specific primers in triplicates using an Applied Biosystem Viia7 RT-PCR machine (Life Technologies). The primer sequences used in this study are provided in Supplementary Table S1 . The delta-delta CT method was used to normalize desired genes to the endogenous housekeeping gene vmhc and determine the relative fold change gene expression.
9
qRT-PCR Gene Expression Analysis
10
Quantifying Gene Expression Profiles in C. elegans
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mRNA was converted to cDNA using a High-Capacity cDNA Reverse Transcription kit (Life Technologies/Invitrogen), as described previously (Machiela et al, 2016 (link)). qPCR was performed using a PowerUp SYBR Green Master Mix kit (Applied Biosystems) in a Viia 7 RT-PCR machine from Applied Biosystems. All experiments were performed with at least three biological replicates collected from different days. mRNA levels were normalized to act-3 levels and then expressed as percentage of wild-type. Primer sequences are as follows:
gst-4 (CTGAAGCCAACGACTCCATT, GCGTAAGCTTCTTCCTCTGC),
hsp-4 (CTCGTGGAATCAACCCTGAC, GACTATCGGCAGCGGTAGAG),
hsp-6 (CGCTGGAGATAAGATCATCG, TTCACGAAGTCTCTGCATGG),
hsp-16.2 (CCATCTGAGTCTTCTGAGATTGTT, CTTTCTTTGGCGCTTCAATC),
sod-3 (TACTGCTCGCACTGCTTCAA, CATAGTCTGGGCGGACATTT),
sod-5 (TTCCACAGGACGTTGTTTCC, ACCATGGAACGTCCGATAAC),
nhr-57 (GACTCTGTGTGGAGTGATGGAGAG, GTGGCTCTTGGTGTCAATTTCGGG),
gcs-1 (CCACCAGATGCTCCAGAAAT, TGCATTTTCAAAGTCGGTC),
trx-2 (GTTGATTTCCACGCAGAATG, TGGCGAGAAGAACACTTCCT),
Y9C9A.8 (CGGGGATATAACTGATAGAATGG, CAAACTCTCCAGCTTCCAACA),
T24B8.5 (TACACTGCTTCAGAGTCGTG, CGACAACCACTTCTAACATCTG),
clec-67 (TTTGGCAGTCTACGCTCGTT, CTCCTGGTGTGTCCCATTTT),
dod-22 (TCCAGGATACAGAATACGTACAAGA, GCCGTTGATAGTTTCGGTGT),
ckb-2 (GCATTTATCCGAGACAGCGA, GCTTGCACGTCCAAATCAAC),
act-3 (TGCGACATTGATATCCGTAAGG, GGTGGTTCCTCCGGAAAGAA).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!