Genelute mrna miniprep kit

Manufactured by Merck Group

Sourced in United States, Germany, Japan

The GenElute mRNA Miniprep Kit is a laboratory product designed for the rapid and efficient extraction of mRNA from a variety of sample types, including cultured cells, tissue samples, and other biological materials. The kit utilizes a simple and streamlined protocol to isolate high-quality mRNA suitable for downstream applications such as gene expression analysis, reverse transcription, and other molecular biology techniques.

Automatically generated - may contain errors

Lab products found in correlation

95 protocols using genelute mrna miniprep kit

Mapping m6A Transcriptome-wide Profile

Check if the same lab product or an alternative is used in the 5 most similar protocols

m⁶A-IP and library preparation were performed according to the reported protocol (Dominissini et al., 2012 (link)). Polyadenylated RNA was extracted using Sigma GenElute™ mRNA miniprep kits. RNA fragmentation Reagents (Ambion) was used to randomly fragment RNA and anti-m⁶A primary antibody (Synaptic Systems) was applied for m⁶A pull down. Captured RNA was washed for 3 times, eluted with m⁶A nucleotide solution and purified by RNA Clean and Concentrator kit (Zymo Research). Sequencing was carried out on Illumina HiSeq 2500 according to the manufacturer’s instructions.

Chang G., Shi L., Ye Y., Shi H., Zeng L., Tiwary S., Huse J.T., Huo L., Ma L., Ma Y., Zhang S., Zhu J., Xie V., Li P., Han L., He C, & Huang S. (2020). YTHDF3 Induces the Translation of m6A-enriched Gene Transcripts to Promote Breast Cancer Brain Metastasis. Cancer cell, 38(6), 857-871.e7.

+ Open protocol

+ Expand

Cloning and Expression of E. histolytica Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from E. histolytica trophozoites by TRIZOL® reagent (Invitrogen, Carlsbad, San Diego, CA). mRNA was purified using GenElute™ mRNA Miniprep Kits (Sigma-Aldrich, Japan). cDNA was synthesized from mRNA using SuperScript™ III RNase H⁻ reverse transcriptase (Invitrogen), and oligo(dT)₂₀ primer (Invitrogen). The E. histolytica gene EHI_178630 was PCR-amplified from cDNA using Phusion DNA polymerase (New England Biolabs, Beverly, MA) using the following primer sets (sense primer; 5′- GTTCCCGGGATGTTGGGTAAAACTGC -3′ and antisense primers; 5′- GAACTCGAGTTAAAGTGATAAATCAATTCCA -3′ or 5′- GAACTCGAGTTAGAGTTGATTTTTCTGGTCTT -3′) for full length (HA-MBOMP30) or β-signal-truncated (HA-MBOMP30^Δ275–282) inserts respectively. After restriction digestion, amplified fragments were ligated into pEhEx-HA65 (link) using Ligation-Convenience Kit (Nippongene, Tokyo, Japan).

Santos H.J., Imai K., Makiuchi T., Tomii K., Horton P., Nozawa A., Ibrahim M., Tozawa Y, & Nozaki T. (2015). A Novel Mitosomal β-Barrel Outer Membrane Protein in Entamoeba. Scientific Reports, 5, 8545.

+ Open protocol

+ Expand

Quantifying m6A Levels in Treated Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted by ESscience RNA-Quick Purification Kit (YiShan Biotech, China), followed by the purification of polyadenylated mRNA using GenElute™ mRNA Miniprep Kit (Sigma-Aldrich, Germany) according to manufacturer’s protocol. Then EpiQuik™ m6A RNA Methylation Quantification Kit (Colorimetric) (Epigentek, USA) was utilized to determine the total level of m6A in treated cells. Briefly, 200 ng RNA was added to each well with the capture antibody and detection antibody mixed in subsequently. After several incubations, the m6A content was quantified colorimetrically at the wavelength of 450 nm and calculated based upon the standard curve.

Chen Y., Peng C., Chen J., Chen D., Yang B., He B., Hu W., Zhang Y., Liu H., Dai L., Xie H., Zhou L., Wu J, & Zheng S. (2019). WTAP facilitates progression of hepatocellular carcinoma via m6A-HuR-dependent epigenetic silencing of ETS1. Molecular Cancer, 18, 127.

+ Open protocol

+ Expand

Methylation-Specific RNA Immunoprecipitation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

meRIP was performed as previously described^{4 (link)}. Briefly total RNA was extracted
using Trizol reagent (Invitrogen). RNA was treated with RNAse-free DNAse I
(Roche) to deplete DNA contamination. PolyA RNA was purified using a
GenElute mRNA Miniprep Kit (Sigma-Aldrich) as per the manufacturer’s
instructions and fragmented using a RNA fragmentation kit (Ambion). Two
hundred micrograms of fragmented RNA was incubated with 3 μg anti-m6A
antibody (Synaptic Systems, catalogue number 202 003; RIP validation and
peer-reviewed citations at https://www.bioz.com/result/affmity purified anti m6
a polyclonal antibody/product/Synaptic
Systems/?r=4.95&cf=0&uq=Synaptic Systems
methyladenosine) in RIP buffer (150mM NaCl, 10mM Tris and
0.1% NP40) for 2 h at 4 °C, followed by the addition of washed
protein A/G magnetic beads (Millipore) and incubation at 4 °C for a
further 2 h. Beads were washed 6 times in RIP buffer and incubated with 50
μl immunoprecipitation buffer containing 0:5 mg
ml⁻¹ m⁶AMP (Sigma-Aldrich) to elute RNA.
Immunoprecipitated RNA was extracted with phenol/chloroform and RNA samples
were sent for high-throughput sequencing.

Wang Y., Li Y., Yue M., Wang J., Kumar S., Wechsler-Reya R.J., Zhang Z., Ogawa Y., Kellis M., Duester G, & Zhao J.C. (2018). N6-methyladenosine RNA modification regulates embryonic neural stem cell self-renewal through histone modifications. Nature neuroscience, 21(2), 195-206.

+ Open protocol

+ Expand

Total RNA Extraction and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cells with TRIZOL reagent (Invitrogen). Polyadenylated RNA was extracted using Genelute mRNA miniprep kit (Sigma), followed by removal of contaminated rRNA with RiboMinus transcriptome isolation kit (Invitrogen). Total RNA samples used for RT-PCR were isolated by using RNeasy kit (Qiagen) with an additional DNase-I digestion step on column.

Yue Y., Liu J., Cui X., Cao J., Luo G., Zhang Z., Cheng T., Gao M., Shu X., Ma H., Wang F., Wang X., Shen B., Wang Y., Feng X., He C, & Liu J. (2018). VIRMA mediates preferential m6A mRNA methylation in 3′UTR and near stop codon and associates with alternative polyadenylation. Cell Discovery, 4, 10.

+ Open protocol

+ Expand

m6A Enrichment and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated with a miRNeasy kit (#217004, QIAGEN) with DNase I digestion. mRNA was extracted from total RNA using a GenElute mRNA Miniprep kit (MRN10, Sigma-Aldrich). Then, a Magna MeRIP m⁶A kit (#17-10499, Millipore) was used according to the manufacturer’s instructions. m⁶A enrichment was analysed by qPCR with specific primers and data were normalized to input. Primer sequences were as follows:
APC Forward: 5′-GAAGGAGTTAGAGGAGGGGC-3′;
APC Reverse: 5′-CCTCCTTGAGCCTCATCTGT-3′.

Wang W., Shao F., Yang X., Wang J., Zhu R., Yang Y., Zhao G., Guo D., Sun Y., Wang J., Xue Q., Gao S., Gao Y., He J, & Lu Z. (2021). METTL3 promotes tumour development by decreasing APC expression mediated by APC mRNA N6-methyladenosine-dependent YTHDF binding. Nature Communications, 12, 3803.

+ Open protocol

+ Expand

Total RNA Extraction and mRNA Enrichment

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA from cells in culture was purified using PerfectPure RNA Cultured Cell Kit (5 Prime) and DNase treated. Enrichment of polyadenylated RNA (PolyA RNA) from total RNA was carried out using GenElute mRNA Miniprep Kit (Sigma-Aldrich). Ribo-Zero Gold rRNA Removal Kit (Illumina) was used to deplete rRNA from PolyA RNA before LC-MS/MS.

Dai Q., Moshitch-Moshkovitz S., Han D., Kol N., Amariglio N., Rechavi G., Dominissini D, & He C. (2017). Nm-seq maps 2′-O-methylation sites in human mRNA with base precision. Nature methods, 14(7), 695-698.

+ Open protocol

+ Expand

m6A RNA Enrichment and Quantification

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was extracted using miRNeasy Mini Kit (Qiaqen #217004) and the mRNA was purified by GenElute™ mRNA Miniprep Kit (Sigma #MRN70). In control experiments (K562 and Kasumi-1 parental or nilotinibR cells), the rRNA was further cleaned using the RiboMinus Transcriptome Isolation Kit (Invitrogen #K155002). About 2 μg mRNA was denatured and subjected to dotblotting using anti-m⁶A antibody (Synaptic Systems #202003) as previously described.^{26 (link),35 (link)} The RNA spotted membrane was stained with 0.02% methylene blue (Sigma #1808) in 0.5 M sodium acetate (pH 5.0) for loading control.

Yan F., Al-Kali A., Zhang Z., Liu J., Pang J., Zhao N., He C., Litzow M.R, & Liu S. (2018). A dynamic N6-methyladenosine methylome regulates intrinsic and acquired resistance to tyrosine kinase inhibitors. Cell Research, 28(11), 1062-1076.

+ Open protocol

+ Expand

Isolation of polyadenylated mRNA from skeletal muscle

Check if the same lab product or an alternative is used in the 5 most similar protocols

High quality RNA (40 µg) from skeletal muscle of 2-, 4- and 9-week-old normal mice, obtained as previously described, was subjected to oligo(dT)-cellulose affinity chromatography in order to isolate polyadenylated (poly(A)⁺) mRNA (GenElute™ mRNA Miniprep Kit, Sigma-Aldrich, Inc., St. Louis, MO, USA). The product was quantified by measuring its absorbance at 260 nm. To obtain the corresponding cDNA, poly(A)⁺ mRNA (20 ng) was subjected to DNase treatment and reverse transcription as described for total RNA. No-reverse transcription controls were also performed.
Assays carried out with isolated mRNA were performed only in skeletal muscle samples from normal animals, leading to three groups consisting in 5 to 6 samples per group, approximately half males and half females.

Piazza V.G., Bartke A., Miquet J.G, & Sotelo A.I. (2017). Analysis of Different Approaches for the Selection of Reference Genes in RT-qPCR Experiments: A Case Study in Skeletal Muscle of Growing Mice. International Journal of Molecular Sciences, 18(5), 1060.

+ Open protocol

+ Expand

RNA Isolation and Quantitative RT-PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

For RNA isolation, TRIzol reagent (Life Technologies) was added to the indicated GSC or LN229 cells, and total RNA was extracted from the cells. mRNA was purified from the total RNA by poly-A selection with GenElute™ mRNA Miniprep Kit (Sigma). cDNAs were synthesized from the purified mRNA by using iScript^TM Reverse Transcription Supermix (Bio-Rad). For quantitative real-time PCR, the PCR reactions were set with PowerUp^TM SYBR^® Green Master Mix (Life Technologies) on a 7500 Fast Real-time PCR System (Applied Biosystems) following the manufacturer’s instruction. Primers used in this study were summarized in Supplementary Table 1.

Fang R., Chen X., Zhang S., Shi H., Ye Y., Shi H., Zou Z., Li P., Guo Q., Ma L., He C, & Huang S. (2021). EGFR/SRC/ERK-stabilized YTHDF2 promotes cholesterol dysregulation and invasive growth of glioblastoma. Nature Communications, 12, 177.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!