Circular ssDNA from the M13 bacteriophage (New England Biolabs) was linearized at a single site using the restriction enzyme BtscI (New England Biolabs) and a site-specific oligonucleotide93 (link). A forward primer containing dual 5′ biotins (Integrated DNA Technologies) was purchased and a reverse 5′ benzylguanine primer was synthesized from a primer with a 5′ primary amine on a 12-carbon linker (IDT) (Supplementary Table 2 ). The synthesis was accomplished with excess BG-GLA-NHS (NEB) in PBS pH 7.4 for 1 h at room temperature and buffer exchanged on a Zeba 7k MWCO desalting column. The forward and reverse primers were used to amplify a 2385 base pair DNA fragment from the linearized M13 template using Q5 DNA Polymerase 2× HotStart Master Mix (NEB). The amplified DNA tether was purified using Ampure XP beads at a ratio of 0.7:1 suspended beads to PCR mix and eluted in TBS + Ca2+ buffer. To minimize damage to the DNA tethers, appropriate techniques were used to minimize unnecessary hydrodynamic stresses, and DNAse-free lab supplies were used to minimize potential degradation. The quality of the DNA tethers was checked with gel electrophoresis, and the tethers were stored at −20 °C in aliquots until use.
Btsci
Manufactured by New England Biolabs
Sourced in United Kingdom, United States
BtsCI is a type II restriction endonuclease that recognizes and cleaves the palindromic DNA sequence 5'-CCWGG-3' (where W = A or T). It is useful for a variety of DNA manipulation and analysis applications.
Automatically generated - may contain errors
10 protocols using btsci
1
Preparation of Biotinylated DNA Tethers from M13 Phage
2
LOH Analysis of Cav-1 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LOH of the Cav-1 gene was determined using an intraexonic SNP (5′-AGCATCC/T-3′) located at +2061 nucleotide (exon 3) from the transcription start site. PCR was performed on each tumor and normal DNA sample pair obtained from 50 patients using primers SNP-1/SNP-2 (Table 1 ). Five μl of the PCR products were used for cutting with the endonuclease BtsCI (NEB, Beverly, MA) and enzyme-digested PCR products were electrophoresed on 2% agarose gels. Signal intensity of fragments and the relative ratio of tumor and normal allele intensities were determined by scanning densitometry.
3
Fabrication of DNA Nanoswitches
4
Analysis of Quinolone Resistance Genes in Enterobacter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
QRDR in gyrA and parC were amplified by PCR and sequenced as described previously.14 (link) Plasmid mediated quinolone resistant determinants qnrA, qnrB, qnrC, qnrD, qnrS, and qepA were amplified14 (link) and sequenced with ABI 3130xl Genetic Analyzer. PCRs for qepA, aac(6ʹ)-Ib,14 (link) and oqxAB15 (link) were carried out. The exact allele of aac(6ʹ)-Ib enzymes was determined with restriction with BtsCI (New England Biolabs, UK). If the allele Ib-cr was present, the PCR product was cut into two segments –270 bp and 210 bp.
The nucleotide sequences were analyzed with Chromas Lite 2.01 (Technelysium Pty Ltd) DNAMAN version 8.0 Software (Lynnon BioSoft) and NCBI Blast tool (http://www.ncbi.nlm.nih.gov). Mutations in QRDR of gyrA and parC were identified with comparison with DNA sequence of QRDR regions of E. cloacae ATCC 13047 (GenBank accession numbers D88980 and D88981 for gyrA and parC, respectively).16 (link)
The nucleotide sequences were analyzed with Chromas Lite 2.01 (Technelysium Pty Ltd) DNAMAN version 8.0 Software (Lynnon BioSoft) and NCBI Blast tool (http://www.ncbi.nlm.nih.gov). Mutations in QRDR of gyrA and parC were identified with comparison with DNA sequence of QRDR regions of E. cloacae ATCC 13047 (GenBank accession numbers D88980 and D88981 for gyrA and parC, respectively).16 (link)
5
DNA Nanoswitch Fabrication Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All DNA nanoswitches were designed and fabricated using previously established protocols (Chandrasekaran et al., 2019 , 2020 (link)). Briefly, circular M13 ssDNA (New England Biolabs) was linearized using the enzyme BtsCI (New England Biolabs). The linearized M13 was mixed with 10× excess of backbone and detection oligos (Integrated DNA technologies, IDT) (sequences of all oligos are provided in Table S2 ) and annealed in a thermal cycler from 90 to 25°C at 1°C/min. After construction, DNA nanoswitches were purified by either HPLC or by PEG precipitation as described previously (Chandrasekaran et al., 2020 (link)).
6
Detecting Wolbachia clade V variants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We analyzed the frequency of clade V wMel variants by testing individual flies in Ancestral, Virus-Selected (at generations 5, 10, and 20), Control (at generation 20), and Bacteria-Selected (evolved against Pseudomonas entomophila, at generation 20) populations.
We extracted DNA from 96 individual female flies of each replicate population following the protocol in (http://www.drosdel.org.uk/molecular_methods.php#prep ) [52 (link)]. Briefly, single flies were squashed in 100 mM Tris-EDTA-NaCl buffer (pH 7.7), 0.5% SDS and incubated at 65°C for 30 minutes. After protein and RNA precipitation with 6M LiCl / 5M KAc, DNA was precipitated using ice-cold isopropanol followed by ethanol cleaning. PCR amplification of the genomic region surrounding position 805,011 was performed using the primers 805011F (5’-AGTCGGGAGCATGAGGGAAAAGT-3’) and 805011R (5’-TTTCAGCATCAGTCGCCTCCGC-3’). The polymorphism was detected by differential cleavage of amplified product with the enzyme BtsCI (NEB). Digestion was performed at 50°C for 60 minutes and the digestion product visualized in an agarose gel. The polymorphism at this position distinguishes wMel variants of clades I, II, III and IV from variants of clades V and VI. In our populations this SNP allows distinguishing clade V variants from clade I/III variants.
We extracted DNA from 96 individual female flies of each replicate population following the protocol in (
7
Molecular Profiling of Antibiotic Resistance in Acinetobacter baumannii
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The QRDRs of the gyrA and parC genes were PCR amplified and subsequently sequenced (Valentine et al., 2008 (link); Hujer et al., 2009 (link)). A. baumannii ATCC 17978 was used as reference for sequence comparison. The 5′- and 3′-nucleotide positions of the primers used to amplify the full QRDR region of gyrA and parC, the annealing temperatures and respective product sizes are mentioned in Supplementary Table S1 . RND-family efflux pump genes (adeB, adeJ, adeG) and MATE-family efflux pump gene (abeM) were screened by PCR and PMQR determinants (qnrA, qnrB, and qnrS) were also checked (Cattoir et al., 2007 (link); Rumbo et al., 2013 (link)). aac(6′)-Ib was amplified with primers known to amplify all known aac(6′)-Ib variants (Park et al., 2006 (link)). Specific bands were digested with BtscI (New England Biolabs, MA) to identify aac(6′)-Ib-cr responsible for ciprofloxacin resistance (Park et al., 2006 (link)).
8
PNPLA3 rs738409 Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PNPLA3 rs738409 polymorphism was genotyped as described using restriction fragment length polymorphism (RFLP) analysis.29 Initially, the region of interest was amplified with conventional PCR (forward primer 5′‐TGGGCCTGAAGTCCGAGGGT‐3′, reverse primer 5′‐CCGACACCAGTGCCCTGCAG‐3′). A PCR product of 333 base pairs (bp) was amplified. Following amplification, PCR products were digested with the restriction enzyme BtsCI (New England Biolabs). Patients who were CC homozygous demonstrated 200 and 133 bp restriction fragments. Patients who were CG heterozygous demonstrated 333, 200 and 133 bp fragments. Patients who were homozygous for the GG mutant allele demonstrated a single 333 bp fragment. An example RFLP result is shown in Figure S1 .
9
Versatile DNA Nanostructure Assembly
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA-construct with anti-dioxigenin and biotin functionalities was assembled from circular M13mp18 ssDNA (New England Biolabs) similar to ref. 44 and 45 in two main steps.
First, the single-stranded plasmid was linearized by enzymatic cleavage using BtscI (New England Biolabs) and a DNA-oligonucleotide complementary to the enzymatic cut site for 60 minutes at 50 °C, followed by a deactivation at 95 °C. 131 complementary oligomers (Intergrated DNA technologies) were designed to complement the single-stranded scaffold resulting in a double stranded DNA-construct with a segmented backbone. The first and last oligomer were functionalized with biotin or digoxigenin to enable attachment to the streptavidincoated micrometer beads and the anti-digoxigenin functionalized surface of the channel wall. In the second step, the construct was assembled in a temperature ramp from 90 °C to 12 °C with -1 °C min -1 using a 10-fold excess of DNA oligomers compared to the scaffold in presence of NEBuffer 2 (New England Biolabs). To prepare the single-stranded DNA construct, the backbone oligomers were omitted from the hybridization protocol (see ESI Fig. 3 for details †). The DNA constructs were stored at 4 °C and used immediately or stored at -20 °C for later use.
First, the single-stranded plasmid was linearized by enzymatic cleavage using BtscI (New England Biolabs) and a DNA-oligonucleotide complementary to the enzymatic cut site for 60 minutes at 50 °C, followed by a deactivation at 95 °C. 131 complementary oligomers (Intergrated DNA technologies) were designed to complement the single-stranded scaffold resulting in a double stranded DNA-construct with a segmented backbone. The first and last oligomer were functionalized with biotin or digoxigenin to enable attachment to the streptavidincoated micrometer beads and the anti-digoxigenin functionalized surface of the channel wall. In the second step, the construct was assembled in a temperature ramp from 90 °C to 12 °C with -1 °C min -1 using a 10-fold excess of DNA oligomers compared to the scaffold in presence of NEBuffer 2 (New England Biolabs). To prepare the single-stranded DNA construct, the backbone oligomers were omitted from the hybridization protocol (see ESI Fig. 3 for details †). The DNA constructs were stored at 4 °C and used immediately or stored at -20 °C for later use.
10
Multiplex PCR for Antibiotic Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total DNA preparations were obtained by thermolysis of isolates as described previously [21] . Multiplex PCR assays were performed on all isolates for the detection of ampC family (bla MOX , bla CMY , bla FOX , bla DHA , bla ACC , bla ACT , and bla MIR ) and PMQR genes (qnrA, qnrB, qnrS, aac(6')-Ib and qepA). The primers used for multiplex PCR ampli cation are listed in Table 1. aac(6')-Ib-cr was differentiated from its wildtype allele by digestion with the enzyme BtsCI (New England Biolabs, Massachusetts, USA). Other βlactamase genes (bla SHV , bla TEM bla CTX-M and bla OXA ) were analysed by PCR using speci c primers and conditions we described previously [22] . qepAMR GTCTACGCCATGGACCTCAC
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!