T4 rna ligase 2

Manufactured by New England Biolabs

Sourced in United States, China, Germany

T4 RNA ligase 2 is an enzyme used for the ligation of RNA fragments. It catalyzes the formation of a phosphodiester bond between the 5'-phosphate and 3'-hydroxyl termini of RNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

57 protocols using t4 rna ligase 2

Fluorescently Labeled RNA Oligonucleotide Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

A short RNA oligonucleotide (sequence provided in Supplementary Note 2) was ordered from IBA Lifesciences, labeled with a Cy5 dye (Sigma-Aldrich), as described previously⁶⁶, and purified using ethanol precipitation. The labeled oligonucleotide was subsequently ligated to a U30-mer with biotin using T4 RNA ligase II (NEB) and a DNA splint (sequence provided in Supplementary Note 2).
Full length mRNA targets (KIF18B sequence or KIF18B sequence with a mutated siRNA target site) were in vitro transcribed using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB), and purified using phenol-chloroform extraction and ethanol precipitation. The complete sequence of the full length mRNA targets is provided in Supplementary Note 2. The full length mRNA targets were ligated to a 22 nt Cy5 labeled and biotinylated RNA oligonucleotide using a 40 nt DNA strand as a splint. The sequences of the oligonucleotide and DNA splint are provided in Supplementary Note 2. After ligation with T4 RNA ligase II (NEB), the ligated constructs were purified from an agarose gel using a Zymo Gel RNA recovery kit (Baseclear).

Ruijtenberg S., Sonneveld S., Cui T.J., Logister I., de Steenwinkel D., Xiao Y., MacRae I.J., Joo C, & Tanenbaum M.E. (2020). mRNA structural dynamics shape Argonaute-target interactions. Nature structural & molecular biology, 27(9), 790-801.

+ Open protocol

+ Expand

Ligase-Mediated RNA Template Assembly

Check if the same lab product or an alternative is used in the 5 most similar protocols

Samples were prepared as 2 mg aliquots of glycholine containing the RNA template at a concentration of 4 × 10⁻⁷ molal (for all template lengths) and with each of the RNA oligonucleotides present in a 4:1 molar ratio with the template (5′-phosphorylated to enable ligation by T4 RNA ligase 2). Samples were heated to denaturing temperatures (95°C for aqueous buffer; 80°C for glycholine) and cooled to 20°C at a constant rate over 20 min. RNA samples were diluted with water, 10× T4 RNA ligase 2 buffer (to a concentration of 1×), and 10 U of T4 RNA ligase 2 (New England Biolabs) to a reaction volume of 20 μl. After incubating for 1 hour at 37°C, 6 μl of each reaction mixture was combined with 6 μl of 2× loading dye (concentration at 2× is: 95% formamide, 0.01% SDS, 0.5 mM EDTA pH 8.0). The resulting sample was heated to 95°C for 3 min and then placed on ice before loading into a 10% denaturing polyacrylamide gel (8 M urea, 1× TBE buffer). Prior to sample loading, gels were pre-run for >30 min at 14 W and 45 V/cm. After sample loading, gels were run at these same conditions for ∼1 h and imaged for Cy3 and Cy5 fluorescence before staining with SYBR Gold (as described above).

He C., Lozoya-Colinas A., Gállego I., Grover M.A, & Hud N.V. (2019). Solvent viscosity facilitates replication and ribozyme catalysis from an RNA duplex in a model prebiotic process. Nucleic Acids Research, 47(13), 6569-6577.

+ Open protocol

+ Expand

Purification of Ligated dsRNA Products

Check if the same lab product or an alternative is used in the 5 most similar protocols

Final composition of the reaction mixture (250 μl) was as follows: 2 μM 5′-phosphorylated-dsRNA, 22.5 units T4 RNA ligase 2 (New England Biolabs), 50 mM Tris-HCl (pH 7.5), 2 mM MgCl₂, 1 mM DTT, 400 μM ATP. After 5′-phosphorylated RNAs had been annealed, T4 RNA ligase 2 (New England Biolabs) was added to the concentrations described above and incubated at 37°C overnight. The RNA was precipitated by the addition of ethanol and sodium acetate (pH 5.2). Ligated products were purified by preparative (1 mm thick) denaturing PAGE (10%PAGE, 25% formamide, 7 M urea in 1X TBE). Bands were visualized by UV shadowing, and crushed and extracted with 0.1 M NaCl. The eluate was desalted by using Slide-A-Lyzer dyalisis columns (ThermoFischer Scientific).

Terrazas M., Ivani I., Villegas N., Paris C., Salvans C., Brun-Heath I, & Orozco M. (2016). Rational design of novel N-alkyl-N capped biostable RNA nanostructures for efficient long-term inhibition of gene expression. Nucleic Acids Research, 44(9), 4354-4367.

+ Open protocol

+ Expand

Splinted RNA Ligation and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

For concatenation by splinted ligation, 500 pmol RNA (containing equal amounts of the individual RNA sequences) and 500 pmol of the DNA splint (ordered from Microsynth, see Supplementary Table 2) were annealed (5 min at 95 °C, 10 min at 25 °C) in annealing buffer (4 mM Tris-HCl (pH 8.0), 15 mM NaCl, 0.1 mM EDTA). Then, MgCl₂ was added to a final concentration of 8 mM along with 1.5 µl 10x T4 RNA ligase 2 buffer and 15 U of the T4 RNA ligase 2 (New England Biolabs, M0239S). Ligation reactions were carried out in a final reaction volume of 15 µl. The ligation reactions were incubated overnight at 25 °C, followed by loading on 15% denaturing PAGE (distributed into 5 wells on a 85 × 70 × 1 mm gel, 200 V, 50 min) with running buffer 1x TBE (89 mM Tris, 89 mM boric acid, 2 mM EDTA, pH 8.3). Synthetic RNAs of 35, 104 and 193 nts were used as size markers. The gels were stained with SYBR green I (Merck, S9430) and imaged on a ChemiDoc Imager (Bio-Rad). Ligation products > 150 nt in length were excised and extracted with TEN buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 300 mM NaCl). The RNA was recovered by precipitation with cold ethanol, yielding around 20-25 ng ligated RNA product per 15 µl ligation reaction. Polyadenylation was done as for randomly ligated products described above.

Chan A., Naarmann-de Vries I.S., Scheitl C.P., Höbartner C, & Dieterich C. (2024). Detecting m6A at single-molecular resolution via direct RNA sequencing and realistic training data. Nature Communications, 15, 3323.

+ Open protocol

+ Expand

miRNA Detection via Ligation and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mixture contained 2 nM each of template miRNA and probes A and B. The procedure was initially performed at 65°C for 8 min. In this step, both the DNA probes identify and hybridize with the target miRNA. Then, 2 U of T4 RNA ligase II and 10× ligation buffer (New England Biolabs, Shanghai, China) were added to the hybridization product, and a total final volume of 50 μl was incubated at 37°C for 1 h to perform the ligation reaction; the products were then immediately placed on ice until it cooled to room temperature (∼15 min).
The FastStart Universal SYBR^® Green Master (Roche, Mannheim, Germany) was used for real-time quantitative PCR assays. The quantitative PCR assays for amplifying the target miRNA were performed with a 20-μl final volume containing 2× SYBR Green Mastermix (ROX), 0.2-μM forward and reverse primers, 5 μl of ligation production, and 4.2 μl of diethylpyrocarbonate-treated water (DEPC-H₂O; Takara Biotechnology, Changchun, China). The reactions were incubated at 95°C for 5 min on a Bio-Rad CFX96 Real-time Thermal Cycler (Bio-Rad, Hercules, CA, United States), followed by 40 cycles of 95°C for 10 s, 60°C for 30 s, and then 72°C for 30 s. All reactions were performed in triplicate.

He Y., Long L., Yan W., Dong L., Xia W., Li C, & Li F. (2021). Establishment and Application of Ligation Reaction-Based Method for Quantifying MicroR-156b. Frontiers in Plant Science, 12, 794752.

+ Open protocol

+ Expand

3' RNA Adaptor Ligation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

600 ng DNase-treated, polyA-depleted nascent RNA was combined with 50 pmol 3′ end adaptor (/5rApp/NNNNNCTGTAGGCAC CATCAAT/3ddC/, Integrated DNA Technologies) and denatured at 65°C for 5 min followed by 4°C for 1 min. Buffer (50 mM Tris-HCl, 10 mM MgCl₂, 1 mM DTT, pH 7.5, 25% PEG 8000), 40 U RNaseOUT, and 200 U T4 RNA ligase II (truncated K227Q) (NEB) were added to the denatured RNA and incubated for 12 hours at 16°C. Samples were cleaned with RNA Clean & Concentrator Kit (Zymo Research).

Alpert T., Straube K., Oesterreich F.C, & Neugebauer K.M. (2020). Widespread Transcriptional Readthrough Caused by Nab2 Depletion Leads to Chimeric Transcripts with Retained Introns. Cell reports, 33(4), 108324.

+ Open protocol

+ Expand

Preparation of U4 RNAs by Splinted Ligation

Check if the same lab product or an alternative is used in the 5 most similar protocols

U4 RNAs encompassing nt 1–83 were prepared by splinted ligation of U4_1 and U4_2 (Supplemental Table 1) containing the appropriate aminoallyl derivatives. Prior to ligation, U4_1 (60 pmol) was phosphorylated with T4 polynucleotide kinase (20U, NEB) for 30 mins at 37°C. U4_2 (120 pmol) and a DNA splint (5′ CAC AAT CTC GGA CGA ATC CTC ACT GAT ATG CGT ATT TCC CGT GCA TAA GGA T – 3′, 100 pmol) were then added and the oligos annealed by heating to 95°C for 5 mins followed by slow cooling to 25°C over 30 min. Following annealing, ligation was carried out by addition of T4 RNA ligase II (10 U, NEB) and incubation at 37°C for 30 min. Ligation products were purified by 12% denaturing polyacrylamide gel electrophoresis (PAGE).

Cornilescu G., Didychuk A.L., Rodgers M.L., Michael L.A., Burke J.E., Montemayor E.J., Hoskins A.A, & Butcher S.E. (2015). Structural analysis of multi-helical RNAs by NMR-SAXS/WAXS: Application to the U4/U6 di-snRNA. Journal of molecular biology, 428(5 Pt A), 777-789.

+ Open protocol

+ Expand

Labeled RNA Fragments for smFRET

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA fragments for smFRET experiments were purchased from IDT containing C6-aminoallyl modifications at the positions indicated (Supplementary Table S1). RNAs were fluorescently labeled with N-hydoxysuccinimidylester derivatives of Cy3 or Cy5 fluorophores (GE Healthcare) by incubation of the RNA (5 nmol) with the fluorophore (40 nmol) overnight at room temperature in labeling buffer (33% v/v dimethylsulfoxide, 100 mM sodium bicarbonate pH 8.5). Excess free dye was removed using an Illustra microspin G-25 column (GE Healthcare). Labeled RNA fragments were then purified by 12% denaturing polyacrylamide gel electrophoresis (PAGE).
The U6_25-112 fragment was prepared by splinted ligation of two labeled RNAs. The 3′ fragment was first phosphorylated at its 5′ end by incubation of the RNA (60 pmol) with T4 polynucleotide kinase (20 units (U), New England Biolabs) in the provided buffer with 3 mM ATP for 30 min at 37°C. The 5′ fragment (120 pmol) and DNA splint (100 pmol) were then added and annealed together with the 3′ fragment by heating to 95°C for 5 min followed by cooling to 25°C over 30 min. T4 RNA Ligase II (10 U, New England Biolabs) was then added, and RNAs ligated for 30 min at 37°C. Ligated products were purified by 12% denaturing PAGE and quantified by measurement of UV-Visible absorbance and use of calculated extinction coefficients for the RNAs.

Rodgers M.L., Didychuk A.L., Butcher S.E., Brow D.A, & Hoskins A.A. (2016). A multi-step model for facilitated unwinding of the yeast U4/U6 RNA duplex. Nucleic Acids Research, 44(22), 10912-10928.

+ Open protocol

+ Expand

Small RNA Library Preparation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small RNAs were treated with RNA phosphatase PIR-1 to remove γ and β phosphates from the 5′ triphosphorylated RNAs.^{64 (link)} Monophosphorylated RNAs were ligated to 3’ adapters (rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight. A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C. Ligated products were reverse transcribed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific) to convert RNA to cDNA libraries. cDNA libraries were amplified by PCR and subsequently sequenced on an Illumina Novaseq platform (SP2 x 50 bp) at the OSU Comprehensive Cancer Center genomics core.

Pastore B., Hertz H.L, & Tang W. (2024). Pre-piRNA trimming safeguards piRNAs against erroneous targeting by RNA-dependent RNA polymerase. Cell reports, 43(2), 113692.

+ Open protocol

+ Expand

tRNA Aminoacylation Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The tRNA-charging assay protocol was adapted from a recent publication (Loayza-Puch et al. 2016 (link)). Briefly, RNA was isolated using acetate-saturated phenol/CHCl₃ (pH 4.8). Precipitated RNA was resuspended in 10 mM NaOAc/HOAc (pH 4.8). Samples were split in two, one half (5 μg) was oxidized with 50 mM NaIO₄ for 30 min at room temperature and the other half (5 μg) was incubated in 50 mM NaCl. Samples were quenched with 100 mM glucose for 5 min at room temperature, purified in G25 columns (GE Healthcare), and then ethanol precipitated. tRNAs were deacylated in 50 mM Tris–HCl (pH 9) for 30 min at 37°C. RNA was precipitated and then ligated to the 3′adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′) using T4 RNA ligase 2 (NEB) for 4 h at 37°C. Relative aminoacylation levels were calculated by qRT-PCR using tRNA-specific primers. Due to similar sequences in some cases, multiple tRNA isoacceptors were detected using the same primer. Primer sequences are as follows: reverse primer, GCCTTGGCACCCGAGAATTCCA; tRNA Leu(CAG/CAA) primer, GTCAGGATGGCCGAGCGGTC; tRNA Leu(IAG/UAG), GGTAGCGTGGCCGAGCGGTC; tRNA Leu(TAA1/2), ACCAGGATGGCCGAGTGGT; i-Met, AGCAGAGTGGCGCAGCG.

Saikia M., Wang X., Mao Y., Wan J., Pan T, & Qian S.B. (2016). Codon optimality controls differential mRNA translation during amino acid starvation. RNA, 22(11), 1719-1727.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!