Magvet universal isolation kit

Right and left genome fragments of approximately 700 to 800 bp flanking the I329L gene were amplified by PCR. The following primers were used for the left flanking fragment encompassing genome positions 157245 to 158064: CATATGTTTTTGAAGCGTTCTAAAAAACATC and ATGTGTGGTTTATTTTAGTATG. The right flanking fragment was amplified with the GAGTTCTTTACCAAAGCC and GGAGGATGACACATATATCTTAACC primers comprising genome positions 158716 to 159434 of the OURT88/3 isolate. Similar fragments were amplified from the Georgia 2007/1 isolate. The obtained DNA fragments were cloned into the pLoxPVP72GUSLoxP vector to construct the pΔI329LGUS plasmids. Pig alveolar macrophages (PAMs) were infected with OURT88/3 or Georgia 2007/1 isolates and transfected with the pΔI329LGUS plasmids using TransIT-LT1 (Mirus Bio, Madison, WI, USA). Recombinant viruses expressing the β-GUS gene were identified by incubation with 5-bromo-4-chloro-1H-indol-3-yl β-D-glucopyranosiduronic acid and purified by limiting dilution. Viral genomic DNA was purified from supernatants from infected porcine macrophages using MagVet™ Universal Isolation Kit (Life Technologies). The analysis of viral DNA was carried out by PCR amplification using primers binding within the I329L deletion (GGACTGTTTGCTGAGGTTGTATG and CCCTTATACTACTTCCTACTGAAACAGG) or flanking regions (GGTTCTATAAATAGCATACTGTACAG and CTGCTGGCATTTCATGCACTTG).

DNA was extracted from the EDTA-anticoagulated blood samples using a MagMAX system (Thermo Fisher) and a Magvet universal isolation kit (Life Technologies). qPCR was carried out following a modified protocol described previously (15 (link), 64 (link)). Infectious virus in blood was titrated by endpoint dilution in PBM cells. Infected cells were detected by immunofluorescence using a monoclonal antibody against the ASFV p30/CP204L protein.
Serum samples were assayed using a commercial competition ELISA kit for the detection of ASFV-specific antibodies against VP72 (Ingezim PPA3 Compac; Ingenasa, Madrid, Spain) and by commercial ELISA kits for the detection of porcine immunoregulatory cytokines (IFN-γ and IL-10; R&D Systems, Abingdon, UK) according to the manufacturers’ instructions. For IFN-α, an in-house ELISA using antibodies purchased from PBL Interferon Source were used as previously described (65 (link)).

Total RNA was extracted from 100μl of blood samples or culture cell supernatants using the QIAcube robot (QIAGEN) or the Kingfisher 96 robot (Life Technologies) with the QIAamp Viral kit (QIAGEN; reference 52906) or the MagVet Universal isolation kit (Life Technologies; reference MV384) according to the manufacturer’s instructions.

DNA was extracted from 100 μl of sample supernatant using the KingFisher Flex Extraction System (Thermo Scientific) using the MagVet^™ Universal Isolation Kit (Life Technologies) following protocol NM_LSI_RRC96. Each extraction was carried out in duplicate and contained ASFV Georgia 2007/1 as a positive control and PBS as a negative control. Extracted DNA was stored at 4°C until it could be analysed by qPCR. qPCR was carried out on a Stratagene Mx3005P (Agilent Technologies, Santa Clara, CA, USA) following a protocol modified from King et al., 2003 as described by King et al., 2011. A standard curve was constructed by the serial dilution of control plasmid, and genome copies were calculated from the standard curve based on the cycle threshold (C_t) values. C_t values >40 were considered negative.

Contaminated milk (500 μl) or tick grindings (100 μl/homogenates) positive for TBEV were diluted in serum-free Dulbeccos’ Modified Eagle Medium (DMEM) culture, inoculated in a T25 flask seeded with Vero NK cells (ATCC: CCL81™) 24 h earlier, and washed with DMEM before inoculation. Following an incubation time of 1 h 30 at 37°C with 5% CO₂, cells were washed twice with PBS, and a complete medium (DMEM + 1% penicillin- streptomycin + 1% sodium pyruvate + 5% fetal calf serum) was added. The cells were observed every day from day 3 to day 7 post-infection (pi). As soon as cytopathic effects (CPE) were detected, the supernatant was collected, clarified, and stored at -80°C. RNA extraction was performed using the MagVet™ Universal Isolation kit (Lifetechnologies, Saint-Aubin, France) on the King Fisher automat (ThermoFisher Scientific, Paris, France). RNA extracts were subjected to TBEV RT-qPCR as described above to confirm TBEV detection.

Mosquito pools were homogenized at 5500 rpm in 2 mL tubes containing silica beads (0.1 mm diameter, BioSpec, Bartlesville, OK, USA) and 500 μL of DMEM with 10% fetal calf serum on a Precellys 24 Dual homogenizer (Bertin, Montigny-le-Bretonneux, France). The homogenate was clarified by centrifugation for 2 min at 1.500 rpm and 120 μL of the supernatant was used for RNA extractions using the MagVet Universal Isolation kit (Lifetechnology, MA, USA) and MagMAX Express-96 Deep Well Magnetic Particle Processor workstation (Thermo Fisher Scientific, MA, USA). The remaining homogenate was stored at −80 °C for subsequent virus isolation.