Log In Sign up
The largest database of trusted experimental protocols

Plv ef1a ires puro

Manufactured by Addgene
Visit Supplier

The PLV-EF1a-IRES-Puro is a plasmid vector that contains the EF1a promoter, an internal ribosome entry site (IRES), and a puromycin resistance gene. This vector can be used for gene expression and selection purposes.

Automatically generated - may contain errors

Lab products found in correlation

Pmscv f del casp9 ires gfp, by Addgene (2 mentions) Pmscv pbabemcs ires rfp, by Addgene (2 mentions) Teto fuw pgk puro, by Addgene (2 mentions) Ires puro, by Addgene (2 mentions) Pimej5gfp, by Addgene (2 mentions) Pmd2 g, by Addgene (2 mentions) Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions) Opti mem reduced serum media, by Thermo Fisher Scientific (1 mentions) Pirfp670 n1, by Addgene (1 mentions) Plv ef1a ires hygro, by Addgene (1 mentions) Puromycin, by Thermo Fisher Scientific (1 mentions) Hygromycin b, by Thermo Fisher Scientific (1 mentions) T4 dna ligase, by New England Biolabs (1 mentions) Bamhi, by Enzynomics (1 mentions) Pcdna3 ova, by Addgene (1 mentions) Pmdlg prre, by Addgene (1 mentions) Protamine sulfate, by Merck Group (1 mentions) Prsv rev, by Addgene (1 mentions) Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions) Vsv g, by Addgene (1 mentions)

15 protocols using plv ef1a ires puro

1

Suicide Switch Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols
The suicide switch plasmid was constructed using the following plasmids: backbone: pLV-EF1a-IRES-Puro (addgene #85132), inducible caspase 9: pMSCV-F-del Casp9.IRES.GFP (addgene #15567), RFP: pMSCV-pBabeMCS-IRES-RFP (addgene #35395). The Ki-67 promoter was amplified from genomic DNA using KI67_promoter_fwd GGGAGCCAAGCTCCAAGGGTTGCTGG and KI67_promoter_rev ATCCGGCCCGCAAGGCCACTTGT. The miR-146a-EGFP plasmid was a gift from Stephen Elledge.
Schepers A., Jochems F., Lieftink C., Wang L., Pogacar Z., Leite de Oliveira R., De Conti G., Beijersbergen R.L, & Bernards R. (2021). Identification of Autophagy-Related Genes as Targets for Senescence Induction Using a Customizable CRISPR-Based Suicide Switch Screen. Molecular Cancer Research, 19(10), 1613-1621.
+ Open protocol
+ Expand
2

Cloning and Lentiviral Transduction of AXIN2

Cited 2 times
Check if the same lab product or an alternative is used in the 5 most similar protocols
The AXIN2 ORF was obtained and copied from the vector pDONR223_AXIN2_WT (#82099, Addgene)101 (link). Given that this AXIN2 ORF contains Serine instead of Proline in position 50 (due to the polymorphism rs2240308), we cloned the ORF from two parts with primers overlapping the SNP (Supplementary Table 3) to change the genotype to the reference allele according to NCBI dbSNP23 (link) build 154 (i.e. nucleotide G, aminoacid Proline). We inserted the ORF in pLV-EF1a-IRES-Puro (#85132, Addgene)102 (link) between the BamHI and MluI sites. Lentiviruses for empty (control) or AXIN2 ORF containing vectors were produced to infect MEC1 cells. After 24 h after infection, selection with 0.75 μg/ml puromycin was started and kept under selection for 1–2 weeks.
Llimos G., Gardeux V., Koch U., Kribelbauer J.F., Hafner A., Alpern D., Pezoldt J., Litovchenko M., Russeil J., Dainese R., Moia R., Mahmoud A.M., Rossi D., Gaidano G., Plass C., Lutsik P., Gerhauser C., Waszak S.M., Boettiger A., Radtke F, & Deplancke B. (2022). A leukemia-protective germline variant mediates chromatin module formation via transcription factor nucleation. Nature Communications, 13, 2042.
+ Open protocol
+ Expand
3

Cloning and Tagging Mouse FOXH1 Transcription Factor

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse FOXH1 cDNA (F: ATGGCCTCGGGCTGGGACCT, R: TTACATGCTGTACCAGGAAAGGAGCCAGCCT) was cloned into the destination vector containing C-terminal triple (S tag-Flag tag-SBP tag, or SFB) tags (Wang et al., 2014 (link)). The resulting mFOXH1-SFB is cloned into pLV-EF1a-IRES-Puro (Addgene, 85132) for lentivirus production. Ezh2 (F: ATGGGCCAGACGGGCAAGAA, R: TCAGGGGATTTCCATTTCTCTCTCAATACC), Eed (F: ATGTCCGAAGCTTCCGGTC, R: TCACCGCAGTCTGTCCCAG), Suz12 (F: ATGGCCCCTCAGAAGCACG, R: TCAGGGCTTCTGCTTTTTGCTGT), Hdac1 (F: ATGGCGCTGAGTCAAGGA, R: TCAGGCAGATTTGGTCTCT) cDNAs were cloned into pCS2+ (modified from Addgene 102860) to generate HA tagged fusion proteins. Foxh1 cDNA (F: ATGAGAGACCCCTCCAGTCTG, R: CTACATTAGACCTTGCCTGCTTGG) was cloned in pCS2+ to generate 3X FLAG tagged fusion protein.
Zhou J.J., Pham P.D., Han H., Wang W, & Cho K.W. (2022). Foxh1 engages in chromatin regulation revealed by protein interactome analyses. Development, growth & differentiation, 64(6), 297-305.
+ Open protocol
+ Expand
4

Lentiviral vector construction and knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols
The lentiviral vector plv-EF1a-ITGB4-IRES-puro and plv-EF1a-ITGA6-IRES-puro were constructed using Plv-EF1a-IRES-puro (#85132; Addgene) vector. The EcoRI and BamHI restriction sites were designed for plasmids construction. The target sequences were cloned by Ruibo (Beijing, China). The lentiviral vectors were co-transfected into HEK-293T cells with psPAX2 and pMD2.G at a ratio of 10:5:2 for lentiviral packaging. The culture medium of HEK-293T was used for transfection of A549 and NCI-H1299 cells. The protein knockdown was examined by western blotting.
Zhao X., Liu C., He X., Wang M., Zhang H., Cheng J, & Wang H. (2022). Laminin-bound integrin α6β4 promotes non-small cell lung cancer progression via the activation of YAP/TAZ signaling pathway. Frontiers in Oncology, 12, 1015709.
+ Open protocol
+ Expand
5

Lentiviral Constructs for NHEJ Efficiency

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Standard cloning procedure was performed to generate a lentiviral construct carrying the EJ5-GFP reporter (Bennardo et al., 2008 (link)) to measure NHEJ efficiency. Promoter-less reporter sequence was PCR amplified from pimEJ5GFP (Addgene, 44026) construct and then inserted into pLV-EF1a-IRES-Puro (Addgene, 85132, with IRES-Puro fragment removed) through the MluI site. PCF11 coding sequence was PCR amplified from HeLa cell cDNAs and inserted into TetO-FUW-pgk-puro (Addgene, 85747) to generate a lentiviral construct expressing PCF11 from a tetracycline-inducible promoter. Insert sequences were verified by Sanger sequencing. All primer sequences are listed in Table S2.
Kunisky A.K., Anyaeche V.I., Herron R.S., Park C.Y, & Hwang H.W. (2021). Shift in MSL1 alternative polyadenylation in response to DNA damage protects cancer cells from chemotherapeutic agent-induced apoptosis. Cell reports, 37(2), 109815.
+ Open protocol
+ Expand
6

Transfection and Immunoblotting of ST6 Mutants

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
HEK293T cells were seeded to 50–70% density in cDMEM. Tagged plasmids were diluted in Opti-MEM reduced serum media (Thermo Fisher Scientific) and combined with Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific) for transfection according to the manufacture’s protocol. Cell lysates were made 24–48 hours later for immunoblotting and co-immunoprecipitation. Full-length ST6 mutants were cloned into the pLV-EF1a-IRES-Puro (Addgene, cat: 85132) (Hayer et al., 2016 (link)) or pLV-EF1a-2a-tEGFR (our lab) backbones.
Yao Y., Kim G., Shafer S., Chen Z., Kubo S., Ji Y., Luo J., Yang W., Perner S.P., Kanellopoulou C., Park A.Y., Jiang P., Li J., Baris S., Aydiner E.K., Ertem D., Mulder D.J., Warner N., Griffiths A.M., Topf-Olivestone C., Kori M., Werner L., Ouahed J., Field M., Liu C., Schwarz B., Bosio C.M., Ganesan S., Song J., Urlaub H., Oellerich T., Malaker S.A., Zheng L., Bertozzi C.R., Zhang Y., Matthews H., Montgomery W., Shih H.Y., Jiang J., Jones M., Baras A., Shuldiner A., Gonzaga-Jauregui C., Snapper S.B., Muise A.M., Shouval D.S., Ozen A., Pan K.T., Wu C, & Lenardo M.J. (2022). Mucus sialylation determines intestinal host-commensal homeostasis. Cell, 185(7), 1172-1188.e28.
+ Open protocol
+ Expand
7

Suicide Switch Plasmid Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols
The suicide switch plasmid was constructed using the following plasmids: backbone: pLV-EF1a-IRES-Puro (Addgene #85132), inducible caspase 9: pMSCV-F-del Casp9.IRES.GFP (Addgene #15567), RFP: pMSCV-pBabeMCS-IRES-RFP (Addgene #35395). The Ki-67 promoter was amplified from genomic DNA using KI67_promoter_fwd GGGAGCCAAGCTCCAAGGGTTGCTGG and KI67_promoter_rev ATCCGGCCCGCAAGGCCACTTGT. The miR-146a-EGFP plasmid was a gift from Stephen Elledge.
Schepers A., Jochems F., Lieftink C., Wang L., Pogacar Z., Leite de Oliveira R., De Conti G., Beijersbergen R.L, & Bernards R. (2021). Identification of Autophagy-Related Genes as Targets for Senescence Induction Using a Customizable CRISPR-Based Suicide Switch Screen. Molecular Cancer Research, 19(10), 1613-1621.
+ Open protocol
+ Expand
8

Lentiviral Constructs for NHEJ Efficiency

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Standard cloning procedure was performed to generate a lentiviral construct carrying the EJ5-GFP reporter (Bennardo et al., 2008 (link)) to measure NHEJ efficiency. Promoter-less reporter sequence was PCR amplified from pimEJ5GFP (Addgene, 44026) construct and then inserted into pLV-EF1a-IRES-Puro (Addgene, 85132, with IRES-Puro fragment removed) through the MluI site. PCF11 coding sequence was PCR amplified from HeLa cell cDNAs and inserted into TetO-FUW-pgk-puro (Addgene, 85747) to generate a lentiviral construct expressing PCF11 from a tetracycline-inducible promoter. Insert sequences were verified by Sanger sequencing. All primer sequences are listed in Table S2.
Kunisky A.K., Anyaeche V.I., Herron R.S., Park C.Y, & Hwang H.W. (2021). Shift in MSL1 alternative polyadenylation in response to DNA damage protects cancer cells from chemotherapeutic agent-induced apoptosis. Cell reports, 37(2), 109815.
+ Open protocol
+ Expand
9

Optogenetic Control of SWELL1 Channels

Check if the same lab product or an alternative is used in the 5 most similar protocols
SWELL1-iRFP was created by replacing GFP from the SWELL1-GFP plasmid with iRFP. iRFP was amplified using piRFP670-N1 (Addgene, plasmid 45457). SWELL1-iRFP was inserted into lentiviral backbone pLV-EF1a-IRES-Puro (Addgene, plasmid 85132). Forty-eight hours post-shRNA transduction, puromycin (0.5 μg/mL, Gibco) was added to a fresh cell culture medium to select stably transduced cells expressing SWELL1-iRFP.
ARHGEF11(DHPH)-Cry2-mCherry (OptoGEF), CAAX-CIBN-GFP, and mito-CIBN-GFP were gifts from Dr. Xavier Trepat (Institute for Bioengineering of Catalonia). Cry2-mCherry was amplified from ARHGEF11(DHPH)-Cry2-mCherry and inserted into pLV-EF1a-IRES-Hygro (Addgene, plasmid 85134). SWELL1 was amplified from SWELL1-iRFP, and then inserted into pLV-EF1a-IRES-Hygro-Cry2-mCherry to create SWELL1-Cry2-mCherry (OptoSWELL1). Hygromycin B (500 μg/mL, ThermoFisher Scientific) was added to a fresh medium 48 h post-transduction to select cells stably transduced with OptoSWELL1.
Zhang Y., Li Y., Thompson K.N., Stoletov K., Yuan Q., Bera K., Lee S.J., Zhao R., Kiepas A., Wang Y., Mistriotis P., Serra S.A., Lewis J.D., Valverde M.A., Martin S.S., Sun S.X, & Konstantopoulos K. (2022). Polarized NHE1 and SWELL1 regulate migration direction, efficiency and metastasis. Nature Communications, 13, 6128.
+ Open protocol
+ Expand
10

Cloning of Coronavirus Spike Proteins

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Plasmids expressing codon-optimized spike proteins of SARS-CoV (strain Frankfurt 1; GenBank accession number AY291315.1), MERS-CoV (strain EMC; GenBank accession number NC_019843.3.1), HCoV-229E (strain Inf-1; GenBank accession number NC_002645.1), HCoV-NL63 (strain Amsterdam I; GenBank accession number AY567487.2), were synthesized by a gene synthesis service (Fasmac). These plasmids were fragmented by restriction enzymes (KpnI, NEB, Cat# R3142L; NotI, NEB, Cat# R3189L) and cloned into the KpnI-NotI site of backbone pCAGGS vector 19 (link) using T4 DNA Ligase (NEB, Cat# M0202L). To construct the plasmids expressing the receptor proteins of coronaviruses, the ORF of human alanyl aminopeptidase, membrane (ANPEP)/CD13 (GenBank accession number NM_001150.3) was prepared by RT-PCR using BjaB cell-derived cDNA as the template and the following primers: hANPEP-MluI-Fwd, 5'-tatatataACGCGTatggccaagggcttctatatttcc-3' and hANPEP-HpaI-Rev, 5'-ttaattaaGTTAACctatttgctgttttctgtgaaccactgg-3'. The ORF of human dipeptidyl peptidase-4 (DPP-4)/CD26 was subcloned from pcDNAhumanDPP4 (kindly provided by Dr. Shuetsu Fukushi) 20 (link). The obtained ORF fragments were inserted into MluI-HpaI site of pLV-EF1a-IRES-Puro (Addgene, Cat #85132).
Barabona G., Ngare I., Kamori D., Nkinda L., Kosugi Y., Mawazo A., Ekwabi R., Kinasa G., Chuwa H., Sato K., Sunguya B, & Ueno T. (2024). Neutralizing immunity against coronaviruses in Tanzanian health care workers. Scientific Reports, 14, 5508.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!