Qiaquick pcr purification kit

DNA fragments with 8-oxoG were purified as previously described [41 (link)]. Briefly, 5 µg of the genomic DNA extracted from sperm was fragmented with an S2 ultrasonicator (Covaris, Woburn, MA, USA) in 10 mM Tris buffer (pH 8.0) to obtain approximately 150-bp fragments. After sonication, the fragmented DNA was concentrated to 20 µL in 100 mM NaPi buffer (pH 8.0), using QIAquick PCR purification kit (Qiagen). A 100 µL volume of 100 mM NaPi buffer with 20 mM amine-PEG2-biotin (Thermo Fisher Scientific) was added and the mixture was heated to 75 °C for 10 min. After thermal equilibration to room temperature, 5 mM K₂IrBr₆ (Sigma-Aldrich) was added for 8-oxoG biotinylation. The biotinylated DNA fragments were eluted with 125 µL Tris buffer using the QIAquick PCR purification kit and collected using Dynabeads MyOne Streptavidin C1 (Thermo Fisher Scientific). Complementary DNA strands to those with bound biotinylated 8-oxoG were released by incubation in 150 mM NaOH at 20 °C for 30 min and concentrated to 10 µL ddH₂O using the ssDNA/RNA Clean & Concentrator kit (Zymo Research, Irvine, CA, USA).

WGA of single cells was conducted using the WGA4 Genomeplex Single Cell Whole Genome Amplification Kit (Sigma Aldrich Cat#. WGA4). Amplification was carried out according to the manufacturer’s protocol, with the exception of amplification performed with 23 PCR cycles. In short, the cells were lysed by adding 1.5 µl lysis buffer (1:1 solution of 100 mM DTT + 400 mM KOH) to each tube containing a single thawed cell and subsequently incubated for 2 min at 95 °C. A master mix containing 6.5 µl 10 mM Tris-HCl-EDTA pH 8.0 per reaction and 1 µl of the 10x Single Cell Lysis & Fragmentation Buffer was added to the cold reaction. The samples were incubated for 4 min at 99 °C. Successful amplification was confirmed by gel electrophoresis (1.5% agarose gel) with a DNA smear around 200–1200 bp. Further, DNA was purified using a QIAquick PCR Purification Kit (Thermo Fisher, Cat#. K210012 with elution in 50 µl of TE-buffer. Concentration of purified DNA was quantified with Qubit Fluorometric Quantification (Thermo Fisher). Amplified DNA was sheared using sonication (Covaris S2/E210 focused-Ultrasonicater) with the microtube setup and the 200 bp target size protocol for DNA shearing. Final sample volume was 75 µL.

Albumin DNA was quantified to verify the cellular input level in the EDITS assay. Briefly, a 197 bp fragment was PCR amplified in 25-µl reactions containing one microliter of cellular DNA, 2 × Bestaq™ DNA polymerase mastermix (Applied Biological Materials) and primers Alb-S (5′-GCTGTCATCTCTTGTGGGCTGT-3′) and Alb-AS (5′-AAACTCATGGGAGCTGCTGGTT-3′) with PCR conditions as described [104 (link)]. Amplicons were purified (QIAquick PCR purification kit) and quantified (Qubit 2.0, Thermo Fisher Scientific).

sgRNAs were synthesized using DNA templates for in vitro transcription. DNA templates were produced using overlapping DNA oligonucleotides in a high-fidelity PCR reaction [49 (link)]. The PCR products were first purified using the QIAQuick PCR purification kit and used as a template for in vitro transcription of the sgRNA with the MEGAshort script T7 kit (ThermoFisher, AM1354). Following in vitro transcription, RNA was purified using the MEGAclear Transcription Clean-Up Kit (ThermoFisher AM1908). All samples were analyzed by Nanodrop to determine concentration and visualized using the Qiaxcel Advanced System using the RNA QC V2.0 kit to check the quality of RNA product before storage at −80 °C. Cas9 mRNA was purchased from ThermoFisher (A25640). All sgRNAs were reanalyzed by Nanodrop prior to assembling the microinjection mixtures. Conditional allele attempts using ssODN donors consisted of Cas9 mRNA (100 ng/μL), sgRNA (20 ng/μL, each), and two ssODNs (100 ng/μL, each) in a final volume of 60 μL of 1×PBS (RNAse-free). Conditional allele attempts using lssDNA donors consisted of Cas9 mRNA (50 ng/μL), sgRNA (10 ng/μL, each), and one lssDNA (50 ng/μL) in a final volume of 60 μL of 1×PBS (RNAse-free). Sequences of donor templates used for loxP insertion are listed in Additional file 1: Table S1.

Plasmid templates for in vitro transcription carry an inactivated T7 promoter, 5′ UTR, Kozak sequence, coding sequences and 3′ UTR. Transcription templates were PCR amplified from these plasmids using Phusion U Green Multiplex Master Mix (Thermo Fisher Scientific) with primers that correct the T7 promoter and add a 119-nt poly(A) tail to the 3′ UTR. After purification of the product with QIAquick PCR Purification Kit (Thermo Fisher Scientific), PE2 and hMLH1dn mRNAs were transcribed from these templates using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) with full replacement of UTP with N1-methylpseudouridine-5′-triphosphate (TriLink Biotechnologies) and co-transcriptional capping by CleanCap Reagant AG (TriLink Biotechnologies). mRNA products were precipitated in 2.5 M lithium chloride, washed twice with 70% ethanol, dissolved in nuclease-free water and stored at −80 °C.

Mutation status of B2M was determined by Sanger sequencing as described previously.^{8 (link)} Briefly, PCR amplification of B2M exons 1 and 2 was performed using primer sequences: Exon 1 For—GGCATTCCTGAAGCTGACA, Exon 1 Rev— AGAGCGGGAGAGGAAGGAC, Exon 2a For—TTTCCCGATATTCCTCAGGTA, Exon 2a Rev—AATTCAGTGTAGTACAAGAG and Exon 2b For—TGTCTTTCAGCAAGGACTGG, Exon 2b Rev—CAAAGTCACATGGTTCACACG. After purification of the obtained PCR products (QIAquick PCR Purification Kit), the sequencing reaction was performed using the BigDye^® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Wilmington, DE, USA). Precipitated products were dissolved in 12 µl of HiDi Formamide (Thermo Fisher Scientific, Wilmington, DE, USA), sequenced on ABI 3130xl Genetic Analyzer and evaluated using Sequencing Analysis Software (Applied Biosystems).