Lentivirus

Manufactured by GenePharma

Sourced in China, United States

Lentivirus is a type of viral vector used in gene delivery applications. It is a retroviral vector derived from the lentivirus family, capable of integrating genetic material into the host cell's genome. Lentivirus can efficiently transduce both dividing and non-dividing cells, making it a versatile tool for genetic engineering and research.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Recombinant lentivirus (35 citations) Recombinant lentiviruses containing full-length ANRIL (4 citations) LV5 lentiviruses (3 citations) Lentiviruses expressing (3 citations) Lentivirus packing shRNA expression vector (3 citations) ShRNA targeting CYLD lentiviruses (2 citations) CB1 shRNA and control shRNA lentivirus (2 citations) Lentivirus packaging (2 citations) Lentivirus empty vector (2 citations) ShRNA recombinant lentiviruses (1 citations)

154 protocols using lentivirus

Lentiviral Transfection of rBMSCs with BMP-2 and TGF-β3

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DNA fragment that encoded human BMP-2 or TGF-β3 that had been cloned into the pIRES vector, was provided by the Central Laboratory at the Medical School of Qingdao University (Qingdao, China). Corresponding lentivirus packaging plasmids were produced by Shanghai GenePharma Co., Ltd. (Shanghai, China).
P3 rBMSCs were divided into four groups as follows: i) Group I, negative controls, consisting of untransfected rBMSCs or rBMSCs transfected with an empty vector (vehicle); ii) group II, rBMSCs transfected with lentivirus carrying green fluorescent protein (GFP)/BMP-2; iii) group III, rBMSCs transfected with lentivirus carrying TGF-β3; iv) group IV, rBMSCs co-transfected with BMP-2 and TGF-β3. The procedure of transfection was performed as previously described (30 (link)). Briefly, rBMSCs were seeded in 6-well culture plates and sequentially infected with lentivirus (Shanghai GenePharma Co., Ltd.) encompassing the indicated genes [multiplicity of infection (MOI) =20, 30, 40, 50, 55 and 60] or negative short hairpin RNA (Lenti-shcontrol) at 80% confluency (~500,000 cells/well) using Polybrene (8 µg/ml culture medium; Sigma-Aldrich; Merck Millipore). The efficiency of transfection was estimated by detecting the proportion of GFP-positive rBMSCs under a fluorescence microscope.

Wang Y., He T., Liu J., Liu H., Zhou L., Hao W., Sun Y, & Wang X. (2016). Synergistic effects of overexpression of BMP-2 and TGF-β3 on osteogenic differentiation of bone marrow mesenchymal stem cells. Molecular Medicine Reports, 14(6), 5514-5520.

+ Open protocol

+ Expand

Constructing PRPF31-eGFP Lentiviral Vectors

Check if the same lab product or an alternative is used in the 5 most similar protocols

PRPF31-eGFP vectors were constructed by Genomeditec (Shanghai, China). Lentivirus was generated from Gene Pharma (Shanghai, China). Briefly, PRPH2 expression plasmid was constructed by inserting the ORF (open reading frame) sequence into a Lentivirus-specific vector and fused to a mCherry fluorescence gene, then packed into Lentivirus (Gene Pharma, Shanghai, China). PRPF31 ORF sequence, as well as 3Flag tag sequence, was inserted into pcDNA3.1-CMV containing a neomycin resistance gene (Gene Pharma).

Xiao X., Ling F., Chen C.B., Liang J., Cao Y., Xu Y, & Chen H. (2022). PRPF31 interacts with PRPH2 confirmed by co-immunoprecipitation and co-localization. Biochemical and biophysical research communications, 629.

+ Open protocol

+ Expand

Lentiviral-Mediated Protein Modulation in HepG2 Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protocols were reported previously.23 (link) Briefly, lentiviruses encoding short hairpin RNA (shRNA, GenePharma) targeting CYLD (Sh-CYLD, 5ʹ-GGAAATAAACTCCAGAGTTTC-3ʹ) and the negative control shRNA sequence (Sh-NC, 5ʹ-TTCTCCGAACGTGTCACGTTTC-3ʹ) were constructed. lentiviruses with constitutively active Akt1 overexpression and their vector controls (CA-akt and Lv-Control) were also purchased from GenePharma. lentiviruses (10⁹ TU/mL) and polybrene (5 μg/mL, Sigma) were added to the medium and incubated with HepG2 cells for 24 h at a multiplicity of infection (MOI) of 20.

Qiu C., Liu K., Zhang S., Gao S., Chen W., Li D, & Huang Y. (2020). Bisdemethoxycurcumin Inhibits Hepatocellular Carcinoma Proliferation Through Akt Inactivation via CYLD-Mediated Deubiquitination. Drug Design, Development and Therapy, 14, 993-1001.

+ Open protocol

+ Expand

Lentiviral Modulation of KCND2 in Gastric Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used RPMI‐1640 medium (Gibco) with 10% fetal bovine serum (FBS, Hyclone) to culture human gastric mucosal epithelial cells GES‐1, while human gastric cancer cells (AGS, HGC‐27, SGC‐7901, MGC‐803) and mouse‐derived gastric cancer cell line MFC were grown in DMEM medium (Gibco) with 10% FBS. All cells were incubated at 37°C and 5% CO₂. Lentiviruses carrying the KCND2 plasmid and KCND2‐specific shRNA were designed and generated by GenePharma Co. Ltd. Subsequently, GC cells were transfected with the Lentiviruses containing either the KCND2 plasmid or shRNA. The transfected cells were then subjected to puromycin selection at a concentration of 1 μg/mL for a duration of 2 weeks.

Zhou H., Su D., Chen Y., Zhang Y, & Huang P. (2023). KCND2: A prognostic biomarker and regulator of immune function in gastric cancer. Cancer Medicine, 12(15), 16279-16294.

+ Open protocol

+ Expand

Lentiviral Knockdown of WDR5 in ESCC

Check if the same lab product or an alternative is used in the 5 most similar protocols

We purchased lentiviruses (GenePharma, Inc.) expressing a shRNA form of WDR5. The ESCC cell lines were seeded in 6-well plates (3*10^5/well) and incubate for 24h. The shRNA targeting WDR5 lentiviruses was transfected into cells with 5mg/mL polybrene (GenePharma). Puromycin selection (2 mg/mL) was applied to select stably transduced cells. Western blotting was performed to confirm the knockdown of WDR5. The sequences of shRNA were as follows:
shNC sense sequences: 5ʹ-UUCUCCGAACGUGUCACGUTT-3ʹ; shNC anti-sense sequences: 5ʹ-ACGUGACACGUUCGGAGAATT-3ʹ; shWDR5 sense sequences: 5ʹ-CACCUGUGAGCCAAACUATT-3ʹ; shWDR5 anti-sense sequences: 5ʹ-UAGUUUGGCUUCACAGGUGTT-3ʹ

Huang D., Chen X., Chen X., Qu Y., Wang Y., Yang Y, & Cheng Y. (2020). WDR5 Promotes Proliferation and Correlates with Poor Prognosis in Oesophageal Squamous Cell Carcinoma. OncoTargets and therapy, 13, 10525-10534.

+ Open protocol

+ Expand

Transient and Lentiviral Transfection of Pancreatic Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the transient cell transfection, once the cells reached 50% confluency in six-well plates, short interfering RNA (siRNA) oligonucleotides for the target gene and the pcDNA3.1 expression vector with the target gene purchased from Gene-Pharma (Shanghai, China) were transiently transfected into Panc-1 and MiaPaCa-2 cells using Lipofectamine 3000 (L3000150, Invitrogen, USA) following the manufacturer’s instructions. The sequences of the oligonucleotides are listed in Table S1.
For the lentivirus infection, an sh-RNA plasmid was constructed and packaged into lentivirus by Gene-Pharma (Shanghai, China). Forty-eight hours after the transfection virus infection, the cells were screened and purified using puromycin (A3740, APExBIO, USA) for 2 weeks.

Zhang X., Zheng S., Hu C., Li G., Lin H., Xia R., Ye Y., He R., Li Z., Lin Q., Chen R, & Zhou Q. (2022). Cancer-associated fibroblast-induced lncRNA UPK1A-AS1 confers platinum resistance in pancreatic cancer via efficient double-strand break repair. Oncogene, 41(16), 2372-2389.

+ Open protocol

+ Expand

Ezrin T567A Mutant Lentiviral Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Using Ezr NM-019357-WT (Ezrin^WT) as template, Ezrin 567-site threonine was mutated to alanine (Ezrin^T567A). After constructing the plasmid and packaging the lentivirus (GenePharma Co., Ltd., Shanghai, China), the lentivirus was used to infect rat PMVECs. Rat PMVECs were spread in a 6-well plate (1 × 10⁶ cells/well), when the cells reached 40–60% confluence, they were incubated with 20% FBS, lentiviruses, and 5 μg/ml polybrene for 24 h, then with normal medium for 48 h. The transfection efficiency was detected by fluorescence microscope, and the knockdown effect was observed by Western blotting.

Zhou Q., Jiang J., Chen G., Qian C, & Sun G. (2021). Inflammatory Immune Cytokine TNF-α Modulates Ezrin Protein Activation via FAK/RhoA Signaling Pathway in PMVECs Hyperpermeability. Frontiers in Pharmacology, 12, 676817.

+ Open protocol

+ Expand

Lentiviral Knockdown and Overexpression of NFAT5 and PGK1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The lentivirus against NFAT5 was purchased from Gene Pharma (Shanghai, China), and the sequences targeting NFAT5 were: sh-1, 5′-GGCACACAGUCUUGUACAUTT-3′ (sense), 5′-AUGUACAAGACUGUGUGCCTT-3′ (antisense) and sh-2, 5′-CACUGAGGUACCUCGUAA-ATT-3′ (sense), 5′-UUUACGAGGUACCUCAGUGTT-3′ (antisense). LV3-pGLV-h1-GFP-puro vector was used for NFAT5 knockdown experiments. For transducing lentivirus, cells were cultured in a six-well plate, and 200 μl lentivirus suspension was added in the presence of 5 μg/ml polybrene (Gene Pharma, Shanghai, China). Forty-eight hours after transduction, 5 μg/ml puromycin was added into culture medium for stable cell line screening. For the PGK1 overexpression assay, PGK1-expressing plasmid was transfected into the cells in the presence of Lipofectamine 3000 (Thermo Fisher Scientific).

Jiang Y., He R., Jiang Y., Liu D., Tao L., Yang M., Lin C., Shen Y., Fu X., Yang J., Li J., Huo Y., Hua R., Liu W., Zhang J., Shen B., Zhang Z, & Sun Y. (2019). Transcription factor NFAT5 contributes to the glycolytic phenotype rewiring and pancreatic cancer progression via transcription of PGK1. Cell Death & Disease, 10(12), 948.

+ Open protocol

+ Expand

Lentiviral-Mediated PVT1 Modulation in Oral Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full length of human PVT1 cDNA was constructed into a lentivirus (Shanghai GenePharma Co., Ltd.), resulting in PVT1 overexpression, and was named LV-PVT1 and the negative control (LV-NC) was obtained from GenePharma. Furthermore, PVT1-shRNA (LV-sh PVT1) was synthesized and cloned into a lentivirus, resulted in PVT1 downregulation and the shRNA negative control (LV-sh NC) was obtained from GenePharma. The sequences were as follow: PVT1-shRNA, 5′-CCUGAUGGAUUUACAGUGATT-3′ and NC-shRNA, 5′-GCUACGAUCUGCCUAAGAUTT-3′. LV-PVT1 or LV-NC or LV-sh PVT1 or LV-sh NC was respectively infected into SCC-25 and CAL-27 cells according to the manufacturer's instructions. After antibiotic selection and constructed for 2 weeks, the stable cells with PVT1 overexpression or downregulation were obtained. Cells were plated in 6-well plates (1×10⁶/well) until reaching 60–70% confluence. Transfection reagent Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), serum-free DMEM and hsa-miR-150-5p mimics (Guangzhou RiboBio Co., Ltd, miR10000451-1-5, 5 nmol) were mixed and incubated at room temperature for 30 min, which were added into the prepared 6-well plates with complete medium with 10% FBS.

Li X, & Ren H. (2020). Long noncoding RNA PVT1 promotes tumor cell proliferation, invasion, migration and inhibits apoptosis in oral squamous cell carcinoma by regulating miR-150-5p/GLUT-1. Oncology Reports, 44(4), 1524-1538.

+ Open protocol

+ Expand

Lentiviral Overexpression of DSTN

Check if the same lab product or an alternative is used in the 5 most similar protocols

The lentivirus with stable overexpression of DSTN was constructed by GenePharma (Shanghai, China), where the overexpression sequence is ATGGCCTCAGGAGTGCAAGTAGCTGATGAAGTATGTCGCAT TTTTTATGACATGAAAGTTCGTAAATGCTCCACACCAGAAGAAATCAAGAAAAGAAAGAAGGCTGTCATTTTTTGTCTCAGTGCAGACAAAAAGTGCATCATTGTAGAAGA Infection was performed following the manufacturer's instructions and uorescence of lentivirus was observed 72h after infection.

Wen R., Zhou L., Jiang S., Fan H., Zheng K., Yu Y., Gao X., Hao L., Lou Z., Yu G., Yang F, & Zhang W. (2023). DSTN Hypomethylation Promotes Radiotherapy Resistance of Rectal Cancer by Activating the Wnt/β-Catenin Signaling Pathway. International journal of radiation oncology, biology, physics, 117(1).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!