PCR amplicons for individual samples were generated by nested PCR using primers listed in Supplementary Table 3 and starting from >50-100 ng of purified gDNA. The first PCR step was performed with GoTaq G2 DNA Polymerase (Promega) according to manufacturer instruction using the following amplification protocol: 95°C x 5’, (95°C x 0.5’, 60°C x 0.5’, 72°C x 0.25’) x 20 cycles, 72°C x 5’. The second PCR step was performed with GoTaq G2 DNA Polymerase (Promega) according to manufacturer instruction using 5 µl of the first-step PCR product and the following amplification protocol: 95°C x 5’, (95°C x 0.5’, 60°C x 0.5’, 72°C x 0.3’) x 20 cycles, 72°C x 5’. Second-step PCR primers were endowed with tails containing P5/P7 sequences, i5/i7 Illumina tags to allow multiplexed sequencing and R1/R2 primer binding sites (Supplementary Table 3 ). PCR amplicons were separately purified performing double-side selection with AmpPure XP beads (Beckman Coulter). Library quality was assessed by LabChip® GX Touch HT (Perkin Elmer). Amplicons were multiplexed and sequenced by GeneWiz on MiSeq 2x300bp paired end sequencing (Illumina).
Gotaq g2 dna polymerase
Manufactured by Promega
Sourced in United States, France, Italy
GoTaq G2 DNA polymerase is a thermostable DNA polymerase enzyme. It is used for DNA amplification in various molecular biology applications.
Automatically generated - may contain errors
Lab products found in correlation
Green gotaq reaction buffer, by Promega (8 mentions)
Pcr nucleotide mix, by Promega (5 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Dneasy plant kit, by Qiagen (3 mentions)
250 bp reads, by Illumina (3 mentions)
Eurogold trifast reagent, by Euroclone (3 mentions)
Qiaamp rna blood mini kit, by Qiagen (3 mentions)
Amplification grade dnase 1 kit, by Merck Group (3 mentions)
Random primer, by Promega (3 mentions)
Colorless gotaq reaction buffer, by Promega (3 mentions)
Labchip gx touch ht, by PerkinElmer (2 mentions)
Amppure xp beads, by Beckman Coulter (2 mentions)
Miseq 2x300bp paired end sequencing, by Illumina (2 mentions)
Dntps, by Promega (2 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Dntp mix, by Thermo Fisher Scientific (2 mentions)
Wizard sv gel and pcr clean up system, by Promega (2 mentions)
Green reaction buffer, by Promega (2 mentions)
Goscript reverse transcription system, by Promega (2 mentions)
Gelred nucleic acid gel stain, by Biotium (2 mentions)
91 protocols using gotaq g2 dna polymerase
1
Multiplexed Amplicon Sequencing Protocol
2
Isolation and Characterization of Bacterial Consortia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
At the end of the biocorrosion experiments, the bacterial consortia were isolated from the samples through the enrichment procedure. The tubes containing 20 mL liquid culture medium (i.e., LB) and 100 µL of the samples were incubated for 3 days at 30 °C under aerobic or anaerobic conditions. Bacterial consortia were stored frozen in 25% glycerol at −80 °C. The genomic DNA was extracted from the isolated bacterial consortia using the Pure Link genomic kit (Invitrogen, Carlsbad, CA, USA).
The RAPD was carried out using genomic DNA, AP5 [23 (link)] or AP12 [24 (link)] specific primers, dNTPs, and GoTaq G2 DNA polymerase (Promega, Madison, WI, USA) as described above.
The PCR amplification of the 16S rRNA gene from the genomic DNA was carried out using 27f and 1492r universal bacterial primers [25 (link)], dNTPs, and GoTaq G2 DNA polymerase (Promega, Madison, WI, USA), as described above.
The RAPD was carried out using genomic DNA, AP5 [23 (link)] or AP12 [24 (link)] specific primers, dNTPs, and GoTaq G2 DNA polymerase (Promega, Madison, WI, USA) as described above.
The PCR amplification of the 16S rRNA gene from the genomic DNA was carried out using 27f and 1492r universal bacterial primers [25 (link)], dNTPs, and GoTaq G2 DNA polymerase (Promega, Madison, WI, USA), as described above.
3
Extraction and RT-PCR Analysis of Plant rRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from three-week-old rosette leaves using the Monarch® Total RNA Miniprep Kit according to the manufacturer’s protocol (NEW ENGLAND Biolabs® Inc., Evry, France). DNase treatment was already included in this kit and no additional treatment was required as PCR amplification confirmed that there were no genomic DNA contaminants left in the total RNA. Reverse transcription was carried out using the Invitrogen™ SuperScript™ IV Reverse Transcriptase (FISHER SCIENTIFIC S.A.S., Illkirch Graffenstaden, France) according to the manufacturer’s protocol using the reverse primer P6 located at the end of the 3′ETS of 45S rRNA. RT-PCR amplification of the 3′ETS was performed using the forward primer P4 and the reverse primer P5 using GoTaq® G2 DNA Polymerase (Promega) and the following PCR program design: 30 cycles of 30 s at 94 °C, 45 s at 55 °C and 45 s at 72 °C. RT-PCR amplification of the 25S rRNA gene was performed using the forward primer P7 and the reverse primer P8 using GoTaq® G2 DNA Polymerase (Promega) and the following PCR program design: 16 cycles of 30 s at 94 °C, 45 s at 55 °C and 45 s at 72 °C. The 25S rRNA gene amplification was used as an internal control within 45 rRNAs for equal cDNA loading. PCR products were diluted 1:10 and resolved by electrophoresis on 1.8% agarose gels in 0.5× TBE buffer running the gel at a maximum of 70 V.
4
Multiplexed Amplicon Sequencing Protocol
5
Profiling FGFR and FGF Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR was performed to evaluate the expression of FGFR-1, -2, -3 and -4 and fibroblast growth factor (FGF)-2 and -8 in TT and MZ-CRC-1 cells. Each PCR reaction was carried out in a final volume of 25 μL using GoTaq® G2 DNA Polymerase (M784B, Promega Corporation, Madison, WI, USA) according to manufacturer’s indications (5 μL of 5X reaction buffer with MgCl2, 1 μL of 10 mM dNTPs, 1 μL of 10 pmol/μL forward primer, 1 μL of 10 pmol/μL reverse primer, 1 μL of cDNA sample and 0.25 μL of 5 U/μL GoTaq® G2 DNA Polymerase). The PCR protocol consisted in an initial denaturation step (5 min, 94 °C), followed by 35 cycles of amplification and a final 7 min extension step. Annealing temperatures were set to 60 °C for the FGFR-1 primer pair and 56°C for the remaining primer pairs. Water was used as negative control. PCR products were visualized using Midori Green Advanced staining (MG04, Nippon Genetics Europe) upon 2% agarose gel electrophoresis.
The primer sequences and the expected length of each amplified fragment are resumed inTable 1 . All primers were synthesized by Eurofins Scientific (Milan, Italy).
The primer sequences and the expected length of each amplified fragment are resumed in
6
Semi-quantitative PCR Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Semi-quantitative PCR was performed using the commercial kit GoTaq G2 DNA polymerase (Promega, Madison, WI, USA) and synthesized cDNA. PCR reactions were performed in a total volume of 12.5 µL using 10 µM for dNTPs (Invitrogen), 0.75 mM MgCl2 (Promega), 1X GoTaq Green Buffer (Promega) and 1.25 U of GoTaq G2 DNA polymerase (Promega). Primer concentration was 50 nM for cd83, mhcI, and mhcII and 25 nM for cd86. A total of 12 ng of cDNA was used for each sample. Cycling conditions were 95 °C for 5 min; 35 cycles at 95 °C for 30 s, 60 °C or 62 °C (depending on the Tm of primers) for 30 s, and 72 °C for 20 s; and 72 °C for 5 min. An Aeris (ESCO, Singapore, Singapore) thermal cycler was used for PCR. Primers sequences used are listed in Table 1 . Samples were stored at −20 °C until analysis in agarose gel electrophoresis.
7
RenSeq-guided Resistance Loci Mapping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Three mapping populations were used in this study: (1) F2 populations of SP2271 × SP2272 and (2) BC1 and (3) F2 populations of SP2271 × SP2300. The populations were phenotyped by agroinfiltration of RXLR effectors. A cork borer was used for sampling, and the leaf discs from the responsive and non-responsive progenies were pooled. The Genomic DNA was isolated using the Qiagen DNeasy plant kit (Qiagen, 69104). RenSeq libraries were then prepared, as described previously24 (link). The libraries were sequenced (Illumina 2 × 250-bp reads) by Novogene (Beijing, China). The SNP filtering and calling steps were described previously26 (link).
To design molecular markers, the 10× PCR-free resequencing reads were mapped to the SP2271 S. americanum reference genome. Then SCAR markers that linked with the BSA-RenSeq signals were designed; amplicons should only be present in the non-responsive allele. The SCAR markers were first tested on the parental lines and the verified markers were then used on genomic DNA from individual non-responsive plants. GoTaq G2 DNA polymerase (Promega, 0000066542) was used for genotyping.
To design molecular markers, the 10× PCR-free resequencing reads were mapped to the SP2271 S. americanum reference genome. Then SCAR markers that linked with the BSA-RenSeq signals were designed; amplicons should only be present in the non-responsive allele. The SCAR markers were first tested on the parental lines and the verified markers were then used on genomic DNA from individual non-responsive plants. GoTaq G2 DNA polymerase (Promega, 0000066542) was used for genotyping.
8
DNA Amplification and Agarose Gel Electrophoresis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For DNA amplification the following components were mixed per sample: 3 µl 5× Green GoTaq buffer (Promega, Madison, WI USA) 1 µl 50 µM Primer forward, 1 µl 50 µM Primer reverse, 2 µl 10 mM dNTP-mix (Thermo Fisher Scientific), 0.15 µl GoTaq G2 DNA Polymerase (Promega) 5 U/µl, 3 µl 25 mM MgCl2, 200 ng DNA-template and adjusted to 25.15 µl with dd-H2O. The reaction-mix was incubated at 94 °C for 4 min, followed by 40 cycles of 30 s at 94 °C, 45 s at 55 °C and 45 s at 72 °C, and once a final step for 5 min at 72 °C. PCR amplifications were analyzed by agarose-gel electrophoresis. Therefore, next to 5 µl 100 bp-DNA-ladder, whole sample volumes were loaded onto a 2% (w/v) agarose-TBE gel (TBE buffer: 90 mM Tris-HCl, 80 mM boric acid, 2 mM EDTA pH 8.3) with 5 µl/100 ml midori-green and run at 50 V for 1 h. DNA separation was visualized under a UV transilluminator and documented by using Gel Doc software (Bio-Rad).
Oligonucleotide sequences (Merck):
Oligonucleotide sequences (Merck):
Cathepsin-Z Forward: CTCATGTTAAACATTAACCAAG
Cathepsin-Z Reverse: CTTCCCATCCTTATAGGTG
Gelsolin Forward: GCCAGTCTAATGAGATATACAC
Gelsolin Reverse CTTATTTTCACCATTTATCTATATG
9
Amplification and Sequencing of Spiroplasma SpAID Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
10 adult Oregon-R females uninfected (as a negative control) or infected with MSRO-Ug, MSRO-H99, and MSRO-SE were collected and genomic DNA was purified (see quantitative PCR methods). The 3’ portion of SpAID gene was amplified with forward and reverse primer sets (spaid_1568F with spaid.L_+136R for MSRO-Ug/MSRO-H99 and spaid.S_+362R for MSRO-SE, respectively) (Supplementary Table 1 ) under the following PCR conditions: 95°C for 2 min followed by 30 cycles of 95°C for 30 sec, 50°C for 30 sec and 60°C for 3 min. Due to the low GC content of the SpAID gene (23.3%), extension at 60°C instead of 72°C was essential for the successful PCR amplification55 (link). The 50-µl PCR mixture contained 2 µl of genomic DNA, 1.25 U of GoTaq G2 DNA polymerase (Promega), 1x green reaction buffer (Promega), 0.5 µM primers, and 0.2 mM dNTP mixture. The PCR fragment was purified from agarose gel by the Wizard SV Gel and PCR Clean-Up System (Promega) and read by direct sequencing. To design sequencing primes, we referred to the genome sequences assembled from the PacBio data. No distinct PCR amplification was detected in uninfected Oregon-R female flies, confirming that the SpAID gene is not encoded by the D. melanogaster genome but by the Spiroplasma genome.
10
Generating B. cinerea Mutant Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
B. cinerea mutant strains used in this study were generated by PEG-mediated protoplast transformation as described by (Kars et al., 2005 (link)) with minor modifications. The constructs of donor templates were made by the yeast recombination method as described by Schumacher (2012) (link). For the construction of plasmids as well as the amplification of donor templates, PCR was performed with the primer sets shown in Supplementary Table 1 Supplementary Table 1
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!