In fusion cloning system

Manufactured by Takara Bio

Sourced in United States, Japan, China, Canada

The In-Fusion cloning system is a DNA assembly method that enables the seamless and directional joining of multiple DNA fragments. It uses an In-Fusion enzyme to fuse DNA sequences with overlapping ends. This method allows for the rapid and efficient construction of recombinant DNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

Tcs sp8, by Leica (3 mentions) Dual luciferase reporter assay system, by Promega (3 mentions) Takara ex taq dna polymerase, by Takara Bio (2 mentions) Pmscv puro vector, by Takara Bio (2 mentions) By4741, by Thermo Fisher Scientific (2 mentions) Pcambia0380, by Takara Bio (2 mentions) Geneart site directed mutagenesis system, by Thermo Fisher Scientific (2 mentions) Mav203, by Takara Bio (2 mentions) Ha nfat1 4 460 gfp, by Addgene (2 mentions) Ha nfat4 3 407 gfp, by Addgene (2 mentions) Infinite m200 system, by Tecan (2 mentions) Lentiv cas9 puro, by Addgene (2 mentions) Artificial dna template, by Eurofins (2 mentions) 7 deaza gtp, by TriLink (2 mentions) Ecori hf, by New England Biolabs (2 mentions) Dnase 1, by Thermo Fisher Scientific (2 mentions) Pcoldii, by Takara Bio (1 mentions) Pegfp n1 vector, by Takara Bio (1 mentions) Hek293t, by American Type Culture Collection (1 mentions) Smarter race 5 3 kit, by Takara Bio (1 mentions)

Spelling variants of this product

In-Fusion cloning (433 citations) In-Fusion (261 citations) In-Fusion system (50 citations)

90 protocols using in fusion cloning system

Cloning and Characterization of YY1 and PPARA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coding sequence of human YY1 and PPARA were PCR amplified from cDNA reverse transcribed from HepG2 cells. Primers YY1-INF: GTTTAAACTTAAGCTTGCCgccatggcctcgggcgaca and YY1-INR: GCCACTGTGCTGGATATCcttcccgtggtcgagaagggt were used to amplify the coding sequence of YY1. For PPARA, primers PPA-INF: TTAAACTTAAGCTTGGTACCgtcgcgatggtggacacgga and PPA-INR: GCCACTGTGCTGGATATCaaggaactcagtacatgtccct were used. The expression plasmids were constructed by inserting the amplicons into pCDNA3.1 through In-fusion cloning system (Takara). The resulting plasmids pCDNA3.1-YY1 and pCDNA3.1-PPARA were verified by Sanger sequencing.
To test the promoter activities, the putative promoter regions were inserted into pGL4.10 (Promega) digested with KpnI and EcoRV through In-fusion cloning system (Takara), except for the promoter region of FADS1 which was constructed by T4 DNA ligation (New England Biolabs). Putative enhancer regions were inserted into pGL4.23 (Promega) digested with KpnI and EcoRV through In-fusion cloning system (Takara). A three fragments In-fusion cloning system with mutations introduced through primer sequences was used to introduce desired mutations into luciferase constructs. The detailed primer information and cloning method for each construct is listed in Table S8. All the resulting plasmids were verified by Sanger sequencing.

Table S8 Luciferase plasmids constructed in this study.

Pan G., Diamanti K., Cavalli M., Lara Gutiérrez A., Komorowski J, & Wadelius C. (2021). Multifaceted regulation of hepatic lipid metabolism by YY1. Life Science Alliance, 4(7), e202000928.

+ Open protocol

+ Expand

Recombinant Production of Bac7 (1-35) Peptide

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A codon optimized ACA-less Bac7 (1–35) gene (cgtcgtattcgtccgcgtccaccgcgtctgccgcgtccgcgcccgcgtccactgccgttcccacgtccaggtccgcgtccgattccacgtccgctgccattcccgtaa) was synthesized (IDT) and cloned into ACA-less pColdPrS₂ (Takara Bio) by using an infusion cloning system (Clontech), generating pColdPrS₂-Bac7 (1–35), which is capable to produce His₆-PrS₂-Bac7 (1–35). PrS₂ consists of two N-terminal half domains of protein S repeated in tandem (Kobayashi et al. 2009 (link), 2012 (link)). His₆-PrS₂ and Bac7 (1–35) was linked with a tetra peptide, Ile-Glu-Gly-Arg as the Factor Xa cleavage site. Factor Xa cleaves the peptide after Arg so that intact Bac7 (1–35) is released after Factor Xa treatment without any extra amino acid residues attached.
The codon-optimized ACA-less SUMO-Bac7 (1–35) gene was synthesized (IDT) and cloned into pColdII (Takara Bio) by using infusion cloning system (Clontech), generating pColdSUMOBac7 (1–35) vector. In order to produce Bac7 (1–35) as a fusion protein, BL21(DE3) cells transformed with either pColdPrS₂-Bac7 (1–35) or pColdSUMO-Bac7 (1–35) were inoculated into 10 ml of LB medium and the culture was incubated at 37 °C. When OD₆₀₀ reached 0.8, the culture was transferred to 15 °C and the fusion proteins were induced by the addition of 1 mM IPTG. The mixture was further incubated for overnight.

Ishida Y, & Inouye M. (2016). Suppression of the toxicity of Bac7 (1–35), a bovine peptide antibiotic, and its production in E. coli. AMB Express, 6, 19.

+ Open protocol

+ Expand

Generation of Drosophila Transgenic Constructs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

To generate pUASTattB-Abl::Myc for expression in S2 cells, the coding region of Abl was recovered from UAS-Abl transgenic flies by PCR, subcloned into pUASTattB-Myc by using the InFusion cloning system following manufacturer's protocol (Clontech, Mountain View, California). We generated pUASTattB-Abl-K417N::Myc by PCR mutagenesis as previously described (O'Donnell and Bashaw, 2013 (link)) from pUASTattB-Abl::Myc. UAS-Dscam[3.36.25.2]::GFP was previously generated as described (Kim et al., 2013 (link)). To generate UAS-DscamΔCyto, the Dscam coding region was digested with SstI and ligated with the GFP cDNA. Pickles2.31 was generously provided by Dr Yusuke Ohba at RIKEN Brain Science Institute (Mizutani et al., 2010 (link)). To generate UAS-Pickles2.31, the Pickles2.31 coding region was subcloned from pCAGGS-Pickles2.31 into pUASTattB using the InFusion cloning system following the manufacturer's protocol (Clontech). Transgenic flies carrying UAS-DscamΔCyto, UAS-Abl::Myc, and UAS-Pickles2.31 were generated by germline transformation with support from BestGene, Inc.

Sterne G.R., Kim J.H, & Ye B. (2015). Dysregulated Dscam levels act through Abelson tyrosine kinase to enlarge presynaptic arbors. eLife, 4, e05196.

+ Open protocol

+ Expand

HEK293T and Mouse Fibroblast Cell Culture

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293T (ATCC, Manassas, VA) and WT and Bax^−/− mouse embryonic fibroblasts (kindly provided by Dr. Richard Youle) were cultured in DMEM medium containing 10% fetal calf serum, 2 M glutamine, 100 U/ml penicillin, and 100 U/ml streptomycin. Antibodies used were: p65 (C-terminus, C-20, sc-372), p65 (N-terminus, F-6, sc-8008x), and IκBα (c-21, sc-371) from Santa Cruz Biotechnology (Dallas, TX); β-actin (AC-15, A5441) from Sigma-Aldrich (St. Louis, MO); PARP-1 (46D11, 9532) and cleaved Caspase-3 (D175, 9661) from Cell Signaling Technology (Danvers, MA); GFP (7.1 and 13.1, 11814460001) from Roche Applied Science (Indianapolis, IN); Hsp90 (610418) and XIAP (610762) from BD Biosciences (San Jose, CA); Bcl-XL (N1C3, GTX105661) from GeneTex (Irvine, CA); RPS3 and phosphorylated RPS3 as previously described [16 (link),17 (link)]. Tumor necrosis factor was purchased from R&D System (Minneapolis, MN). The GFP-tagged p65 plasmid was previously described [27 (link)]. The GFP-p65^1-97 plasmid was created by inserting the appropriate fragments into the pEGFP-N1 vector (Clontech Laboratories, Mountain View, CA) using the InFusion Cloning System (Clontech Laboratories).

Wier E.M., Fu K., Hodgson A., Sun X, & Wan F. (2015). Caspase-3 cleaved p65 fragment dampens NF-κB-mediated anti-apoptotic transcription by interfering with the p65/RPS3 interaction. FEBS letters, 589(23), 3581-3587.

+ Open protocol

+ Expand

Identification and Cloning of S. haematobium TRPM PZQ

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genome sequences were accessed either through WormBase ParaSite v16 (33 (link)) or individual project data repositories deposited on NCBI. TRPM_PZQ candidate sequences were identified by BLAST searches, and then genome sequence information was manually curated. For the calculation of TRPM_PZQ amino acid identity, sequences were aligned using MAFFT (v6.864) and aligned sequences analyzed using the Ident and Sim interface using standard groups for amino acid similarity (65 (link)). The full-length sequence of S. haematobium TRPM_PZQ (Sh.TRPM_PZQ) was cloned from S. haematobium total RNA using RT-PCR and 5'-RACE. 5′-RACE was performed using the SMARTer RACE 5′3′ Kit (Clontech). Briefly, total RNA (0.5 to 1 µg) was reverse-transcribed using a SMARTer II A Oligonucleotide (42 °C for 1.5 h) to obtain first-strand cDNA. 5′RACE RT-PCR was performed using first-strand cDNA, Sh.TRPM_PZQ gene-specific primers, and a universal primer mix using the following touchdown PCR conditions: 5 cycles (94 °C for 30 s and 70 °C for 3 min), 5 cycles (94 °C for 30 s, 68 °C for 30 s, and 72 °C for 3 min), and then, the mixture was amplified for 30 cycles (94 °C for 30 s; 63 °C for 30 s and 72 °C for 3 min). The RACE PCR products were cloned into pRACE vector using In-Fusion Cloning system (Clontech) and sequenced (Retrogen, Inc).

Rohr C.M., Sprague D.J., Park S.K., Malcolm N.J, & Marchant J.S. (2022). Natural variation in the binding pocket of a parasitic flatworm TRPM channel resolves the basis for praziquantel sensitivity. Proceedings of the National Academy of Sciences of the United States of America, 120(1), e2217732120.

+ Open protocol

+ Expand

CEPDL1 and CEPDL2 Promoter Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For β-glucuronidase (GUS) reporter-aided analysis of the promoter activities of CEPDL1 and CEPDL2, we amplified the 2.0-kb upstream sequences of the predicted ATG start codons of each gene by genomic PCR, and cloned the fragments into a promoter-less pBI101 vector upstream of the GUS reporter gene using the In-Fusion cloning system (Clontech). GUS activity was visualized using X-Gluc as substrate using a conventional protocol.

Ota R., Ohkubo Y., Yamashita Y., Ogawa-Ohnishi M, & Matsubayashi Y. (2020). Shoot-to-root mobile CEPD-like 2 integrates shoot nitrogen status to systemically regulate nitrate uptake in Arabidopsis. Nature Communications, 11, 641.

+ Open protocol

+ Expand

Subcellular Localization of BHP in Guard Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

To analyze the subcellular localization of BHP in guard cells, we generated the transgenic plants expressing BHP-GFP under the control of 35S promoter. The full-length cDNA of BHP was amplified by PCR using primers 5′-CATGCCATGGAAGAGGATTATCAACAGC-3′ and 5′-CATGCCATGGCCAAATGTGAACCGGATGATG-3′, and was cloned into the NcoI site of the CaMV35S-sGFP(S65T)-NOS3′ vector43 (link). The cDNA of the BHP-GFP was amplified by PCR from the resulting vector using primers 5′-CATATGCCCGTCGACATGGAAGAGGATTATCAACAGC-3′ and 5′-TCAGAATTCGGATCCTTACTTGTACAGCTCGTCCATGCC-3′ and cloned into the pRI 101-AN DNA vector (Takara) using the In-Fusion cloning system (Clontech). The resulting construct was introduced into Arabidopsis plants (Col) using an Agrobacterium-mediated transformation method42 (link). The transgenic plants were selected based on the kanamycin resistance of the introduced T-DNA. GFP fluorescent signal from guard cells was detected in the epidermis of rosette leaves using a confocal laser microscope (FV10i; Olympus).

Hayashi M., Inoue S.I., Ueno Y, & Kinoshita T. (2017). A Raf-like protein kinase BHP mediates blue light-dependent stomatal opening. Scientific Reports, 7, 45586.

+ Open protocol

+ Expand

Heterologous Expression of Flag-tagged CYP450s in Yeast

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

For heterologous expression of Flag-tagged CYP450s in yeast (S. cerevisiae), the full-length coding region of each CYP450 candidate was cloned between SpeI and NcoI restriction sites of MCS1 of the dual plasmid pESC-Leu2d with a CPR in MCS2^{30 (link),38 (link)} yielding pESC-Leu2d::CYP/CPR using In-Fusion cloning system (Takara Clontech). The resulted pESC-Leu2d::CYP/CPR was transformed to the protease-deficient yeast strain YPL 154C:Pep4KO and yeast harbouring pESC-Leu2d::CPR was used as the negative control. To optimize HCPT production, we used Δerg6 Δtop1 yeast double mutant strain SMY75-1.4A43, which was previously generated to allow better penetration of, and improved resistance to, topoisomerase I inhibitors such as CPT. The conditions for yeast culture, microsome preparation and immunoblot analysis are included in the Supplementary Methods.

Nguyen T.A., Nguyen T.D., Leung Y.Y., McConnachie M., Sannikov O., Xia Z, & Dang T.T. (2021). Discovering and harnessing oxidative enzymes for chemoenzymatic synthesis and diversification of anticancer camptothecin analogues. Communications Chemistry, 4, 177.

+ Open protocol

+ Expand

Subcellular Localization of CmbHLH2 and CmMYB6

Check if the same lab product or an alternative is used in the 5 most similar protocols

The subcellular localization of CmbHLH2^Full, CmbHLH2^Short, and CmMYB6 was analyzed in Arabidopsis protoplasts as described by Yoo et al. (2007) (link). GFP fusion constructs were generated in the p326-sGFP plasmid, which contains the cauliflower mosaic virus 35S (CaMV 35s) promoter. For the C-terminal GFP fusion, the ORFs of CmbHLH2^Full, CmbHLH2^Short, and CmMYB6 were individually amplified using gene-specific primer sets (p326-CmbHLH2^Full-F/R, p326-CmbHLH2^Short-F/R, and p326-CmMYB6-F/R), which introduced an XbaI site upstream of the ATG codon, using the InFusion Cloning System (Clontech). The resulting p326-CmbHLH^Full-sGFP, p326-CmbHLH2^Short-sGFP, and p326-CmMYB-sGFP plasmids were sequenced to confirm the absence of errors during PCR amplification. The plasmids were introduced into Arabidopsis protoplasts prepared from leaf tissues by polyethylene glycol-mediated transformation. Fusion construct expression was monitored 16–20 h after transformation, and images were captured by fluorescence confocal microscopy (Leica TCS SP8, Leica Microsystems, Germany).

Lim S.H., Kim D.H., Jung J.A, & Lee J.Y. (2021). Alternative Splicing of the Basic Helix–Loop–Helix Transcription Factor Gene CmbHLH2 Affects Anthocyanin Biosynthesis in Ray Florets of Chrysanthemum (Chrysanthemum morifolium). Frontiers in Plant Science, 12, 669315.

+ Open protocol

+ Expand

Expression and Mutational Analysis of Insulin Receptors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The expression vectors for IRA, IRB, non-glycosylatable form of IRA, GFP-tagged IRβ, HA-tagged BACE1 and BACE2, ADAM17, ADAM10, TNF-α and the vectors containing human BACE1 shRNA were described elsewhere^{35 (link),37 (link),49 (link),57 –59 (link)}. The intracellular fragment of IR was generated by PCR amplification and cloned into pcDNA3 expression vector. Mutated forms of IR (N₉₃₃A, W₉₃₆H, T₉₃₇M, F₉₄₂K/Y₉₄₃K and A_946-949), inactive form of BACE1 (D₂₈₉A)^{47 (link)} and mutated form of BACE1 (T₄₇A) were created using the GeneArt site-directed mutagenesis system (Thermo Fisher). Expression vector for IRβ N-terminally fused to Gaussia Luciferase was generated by homologous recombination using the In-fusion cloning system (Clontech).

Meakin P.J., Mezzapesa A., Benabou E., Haas M.E., Bonardo B., Grino M., Brunel J.M., Desbois-Mouthon C., Biddinger S.B., Govers R., Ashford M.L, & Peiretti F. (2018). The beta secretase BACE1 regulates the expression of insulin receptor in the liver. Nature Communications, 9, 1306.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!