Hs00237052 m1

For staining, 2 × 10⁵ cells/well were centrifuged in V-bottom 96-well plates and washed with phosphate-buffered saline (PBS, Lonza) containing 0.5% bovine serum albumin (Lonza), 1% FBS and 0.1% sodium azide. Non-specific binding was blocked by pre-incubating the cells with 40 μg/ml rat IgG (Sigma; 100 μl final volume, 20 min, 4°C). Cells were incubated with anti CXCR4-APC mAb (BD Pharmingen; clone 12G5) or isotype matched mAb (30 min, 4°C). Samples were analyzed on a Navios cytometer (Beckman Coulter).
For qRT-PCR, cell culture RNA was obtained using RNeasy Mini Kit (Qiagen) according to the manufacturer's protocol. The relative expression level of mRNA encoding human CXCR4 was determined by quantitative RT-PCR using GUS gene expression as internal control. cDNA was synthesized from 1 μg of total RNA with the Superscript IV First-Strand Synthesis System (Invitrogen). The cDNA was amplified in duplicate with primers for human CXCR4 (Hs00237052_m1, Applied Biosystems) and for human GUS (Fw: 5′-GAAAATATGTGGTTGGAGAGCTCATT−3′, Rv: 5′-CCGAGTGAAGATCCCCTTTTTA−3′; Probe: 5′-[6FAM] CCAGCACTCTCGTCGGTGACTGTTCA[TAMRA]−3′; all from Sigma). Amplification (1 cycle: 50°C for 2 min, 95°C for 10 min; 50 cycles: 95°C for 15 s, 60°C for 1 min) was monitored using the Roche LightCycler 480. Relative expression was analyzed using 2^−ΔCT method, where ΔCT = (Ct gene of interest- Ct internal control).

Total RNA was extracted, quantified and reversely transcribed to cDNA as described before^{30 (link)}. Quantitative RT-PCR was used to measure the relative mRNA expression of CXCR7 (ACKR3, Hs00604567_m1, Applied Biosystems) and CXCR4 (Hs00237052_m1, Applied Biosystems). Ct values were normalized against the endogenous control TBP (Applied Biosystems). Negative controls without cDNA were always included.