In order to get MCF7, MDA-MB-231 and U2OS cells stably over-expressing ETV7 and the empty control, cells were seeded in 6-well plates and subsequently transfected for 48 hours with 1 μg of pCMV6-Entry-Empty or pCMV6-Entry-ETV7 (Origene) using Lipofectamine LTX and Plus Reagent (Life Technologies) or FuGene HD (Promega, Milan, Italy) respectively for MCF7 or MDA-MB-231 and U2OS cells. Afterwards, cells were split and Geneticin (Life Technologies) was added at a concentration of 600 and 800 μg/ml respectively for MCF7 or MDA-MB-231 and U2OS cells; each 3 days medium was replaced and after 4 cycles of selection, single cell cloning was performed according to the Corning protocol for cell cloning by Serial dilution in 96 well plates. During the single cell cloning procedure Geneticin concentration was gradually reduced to 300 (MCF7) and 400 μg/ml (MDA-MB-231 and U2OS).
Pcmv6 entry etv7
Manufactured by OriGene
Sourced in Italy
The PCMV6-Entry-ETV7 is a plasmid vector designed for the expression of the ETV7 gene in mammalian cell lines. It contains the human cytomegalovirus (CMV) promoter for high-level transgene expression and the pUC origin of replication for propagation in E. coli.
Automatically generated - may contain errors
Lab products found in correlation
Pcmv6 entry empty, by OriGene (2 mentions)
Ddk myc tags, by OriGene (2 mentions)
Lipofectamine ltx and plus reagent, by Thermo Fisher Scientific (1 mentions)
Geneticin, by Thermo Fisher Scientific (1 mentions)
Fugene hd, by Promega (1 mentions)
Dynabeads protein a magnetic beads, by Thermo Fisher Scientific (1 mentions)
Prl sv40, by Promega (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
4 protocols using pcmv6 entry etv7
1
Stable ETV7 Overexpression in Cell Lines
2
Immunoprecipitation of ETV7 in MCF7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MCF7 were seeded in p150 dishes and transiently transfected with pCMV6-Entry-ETV7 as above (Origene). 48 hours post-transfection cells were lysed in CHAPS buffer and then incubated over-night with an anti-ETV7 antibody (H-88, sc-292,509) or normal rabbit IgG (sc-2027) previously bound to Dynabeads protein A magnetic beads (Life Technologies). Beads were then washed and the immunoprecipitated lysate was eluted and loaded on a polyacrylamide gel for SDS-PAGE.
3
Cloning and Characterization of DNAJC15 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression vectors pCMV6-Entry-Empty, pCMV6-Entry-ETV7 and pCMV6-Entry-DNAJC15 C-terminally tagged with DDK-Myc tags were purchased from Origene (Tema Ricerca, Bologna, Italy).
pGL4.26-DNAJC15 reporter was obtained by cloning the promoter region of DNAJC15 (−299 to +512 bp from TSS according to the Eukaryotic Promoter Database, http://epd.vital-it.ch/) amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs, Euroclone, Milan, Italy) and the following primers (Eurofins Genomics): Fw: GCCTCGAGCAGCACAAACTCATTTGAGGG and Rv: GCAAGCTTAGGCGGCCCGGAGACTCAAG. Purified PCR product was inserted into pGL4.26 backbone using Xho I and Hind III restriction endonucleases. Cloning was checked by restriction analysis and direct sequencing (Eurofins Genomics). For site-directed mutagenesis of this vector please refer to the section below. The pRL-SV40 (Promega) vector constitutively expressing the Renilla reniformis luciferase cDNA was used as transfection efficiency control for gene reporter assays.
pGL4.26-DNAJC15 reporter was obtained by cloning the promoter region of DNAJC15 (−299 to +512 bp from TSS according to the Eukaryotic Promoter Database, http://epd.vital-it.ch/) amplified with Q5 High Fidelity DNA Polymerase (New England Biolabs, Euroclone, Milan, Italy) and the following primers (Eurofins Genomics): Fw: GCCTCGAGCAGCACAAACTCATTTGAGGG and Rv: GCAAGCTTAGGCGGCCCGGAGACTCAAG. Purified PCR product was inserted into pGL4.26 backbone using Xho I and Hind III restriction endonucleases. Cloning was checked by restriction analysis and direct sequencing (Eurofins Genomics). For site-directed mutagenesis of this vector please refer to the section below. The pRL-SV40 (Promega) vector constitutively expressing the Renilla reniformis luciferase cDNA was used as transfection efficiency control for gene reporter assays.
4
Lentiviral Vector Cloning of ETV7
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression vector pCMV6-Entry-ETV7 C-terminally tagged with DDK-Myc tags was purchased from Origene (Tema Ricerca, Bologna, Italy). The lentiviral vector pAIP-ETV7 was obtained by cloning using the following primers to amplify the ETV7 gene from pCMV6-Entry-ETV7 and inserting it into the pAIP-Empty plasmid (the tails containing restriction endonucleases’ target sequences are indicated in lowercase):
Fw: aggttaacATGCAGGAGGGAGAATTGGCTA
Rv: gagaattcTTAAACCTTATCGTCGTCATCC
pAIP was a gift from Jeremy Luban (Addgene plasmid #74171;http://n2t.net/addgene:74171 ; Watertown, MA, USA). Purified PCR product was inserted into the pAIP backbone using HpaI and EcoRI restriction endonucleases (New England Biolabs, Euroclone, Milan, Italy). Correct cloning was checked by restriction analysis and direct sequencing (Eurofins Genomics).
pCMV-D8.91 and pCMV-VSVg plasmids for lentiviral particles production were obtained from Prof. Anna Cereseto, Laboratory of Molecular Virology, CIBIO Department, University of Trento, Italy.
Fw: aggttaacATGCAGGAGGGAGAATTGGCTA
Rv: gagaattcTTAAACCTTATCGTCGTCATCC
pAIP was a gift from Jeremy Luban (Addgene plasmid #74171;
pCMV-D8.91 and pCMV-VSVg plasmids for lentiviral particles production were obtained from Prof. Anna Cereseto, Laboratory of Molecular Virology, CIBIO Department, University of Trento, Italy.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!