Log In Sign up
The largest database of trusted experimental protocols

Ncounter technology

Manufactured by NanoString
Visit Supplier
Sourced in United States

The nCounter technology by NanoString is a digital analysis system that enables direct, multiplexed measurement of gene expression and other molecular biomarkers from a single sample. It utilizes color-coded molecular barcodes and single-molecule imaging to detect and count hundreds of unique transcripts simultaneously.

Automatically generated - may contain errors

Lab products found in correlation

Nsolver 3, by NanoString (3 mentions) Ncounter digital analyzer, by NanoString (3 mentions) Nsolver 4, by NanoString (3 mentions) Pancancer immune panel, by NanoString (3 mentions) Agilent bioanalyzer, by Agilent Technologies (3 mentions) High pure ffpet rna isolation kit, by Roche (3 mentions) Nsolver analysis software, by NanoString (2 mentions) Ncounter prep station and digital analyzer, by NanoString (2 mentions) Truxtrac ffpe total na kit, by Covaris (2 mentions) Ds 11 spectrophotometer, by DeNovix (2 mentions) Ncounter gx human immunology kit, by NanoString (1 mentions) Ncounter human cancer reference kit, by NanoString (1 mentions) Rnase free dnase set, by Qiagen (1 mentions) Mirneasy ffpe kit, by Qiagen (1 mentions) Rneasy ffpe kit, by Qiagen (1 mentions) Ncounter autoimmune profiling panel, by NanoString (1 mentions) Allprep dna rna mini kit, by Qiagen (1 mentions) Ncounter pancancer pathway panel, by NanoString (1 mentions) Nsolver analysis software version 2, by NanoString (1 mentions) Io 360 gene expression panel, by NanoString (1 mentions)

Spelling variants of this product

NCounter analysis technology (6 citations) NCounter Elements technology (3 citations)

43 protocols using ncounter technology

1

Comparing Gene Expression Profiles of Ex Vivo and Reactivated Tumor-Infiltrating Lymphocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 8

The eTIL and rTIL were assessed identify similarities and/or differences in the gene expression profile of rTIL and eTIL.

In the study, Nanostring's nCounter technology was utilized, which employs a color-coded barcode multiplexed to mRNA to deliver a digital readout of gene expression. Purified RNA (RNeasy, Qiagen) from six matched eTIL and rTIL samples were hybridized with an nCounter Immunology V2 panel codeset for 16 hours on a thermocycler. Codesets consist of a mixture of capture and reporter probes that are multiplexed with the target RNA through 22 bp interactions during thermocycling. Samples were loaded into a 12-well SPRINT cartridge and ran on an nCounter SPRINT device. Count data are exported in a custom RCC format and matched to an RLF file which matches gene names to probe IDs. Normalization and analysis were done on nSolver 3.0 (NanoString Technologies, Inc.).

The results of this study are illustrated in FIGS. 12 and 13. As shown in FIGS. 12 and 13, the gene expression profile is significantly different when comparing the eTIL and rTIL (see the heat map in FIG. 12). There are several genes that are significantly upregulated or downregulated in the rTIL compared to the eTIL (FIG. 13).

US11401507B2. Remnant tumor infiltrating lymphocytes and methods of preparing and using the same (2022-08-02). Iovance Biotherapeutics, Inc. [US]. Inventors: Michelle R. Simpson-Abelson [US], Christopher Mosychuk [US], Michael T. Lotze [US].
+ Open protocol
+ Expand
2

Comparative Gene Expression Analysis of Ex Vivo and In Vivo Expanded TILs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 8

The eTIL and rTIL were assessed identify similarities and/or differences in the gene expression profile of rTIL and eTIL.

In the study, Nanostring's nCounter technology was utilized, which employs a color-coded barcode multiplexed to mRNA to deliver a digital readout of gene expression. Purified RNA (RNeasy, Qiagen) from six matched eTIL and rTIL samples were hybridized with an nCounter Immunology V2 panel codeset for 16 hours on a thermocycler. Codesets consist of a mixture of capture and reporter probes that are multiplexed with the target RNA through 22 bp interactions during thermocycling. Samples were loaded into a 12-well SPRINT cartridge and ran on an nCounter SPRINT device. Count data are exported in a custom RCC format and matched to an RLF file which matches gene names to probe IDs. Normalization and analysis were done on nSolver 3.0 (NanoString Technologies, Inc.).

The results of this study are illustrated in FIGS. 12 and 13. As shown in FIGS. 12 and 13, the gene expression profile is significantly different when comparing the eTIL and rTIL (see the heat map in FIG. 12). There are several genes that are significantly upregulated or downregulated in the rTIL compared to the eTIL (FIG. 13).

US11293009B2. Remnant tumor infiltrating lymphocytes and methods of preparing and using the same (2022-04-05). Iovance Biotherapeutics, Inc. [US]. Inventors: Michelle R. Simpson-Abelson [US], Christopher Mosychuk [US], Michael T. Lotze [US].
+ Open protocol
+ Expand
3

Gene Expression Analysis in Scleroderma

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA samples, used for analysis of gene expression, were analyzed using nCounter technology (NanoString Technologies, Seattle, WA, USA). Expression of genes was normalized to 12 housekeeping genes. Of the 83 genes selected for confirmation expression analysis, 62 transcripts were significantly overexpressed and two were significantly underexpressed in SSc patients compared with healthy controls (t-test, Bonferroni correction for multiple comparisons). Microarray data from the faSScinate trial, used for selecting prognostic genes, has been deposited in NCBI GEO, ID# GSE106358.
Stifano G., Sornasse T., Rice L.M., Na L., Chen-Harris H., Khanna D., Jahreis A., Zhang Y., Siegel J, & Lafyatis R. (2018). Skin gene expression is prognostic for the trajectory of skin disease in patients with diffuse cutaneous systemic sclerosis. Arthritis & rheumatology (Hoboken, N.J.), 70(6), 912-919.
+ Open protocol
+ Expand
4

Multiplexed Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Nanostring nCounter technology (www.nanostring.com) allows expression analysis of multiple genes (up to 800 genes) from a single sample. We performed nCounter multiplexed target profiling of inflammation genes in mice (nCounter® Mouse Inflammation Kit) and immune genes in human (nCounter® GX Human Immunology Kit) which consist of genes differentially expressed during inflammation and immune responses, nCounter miRNA (nCounter Mouse and Human miRNA Assay Kits) and Nanostring MG400 and MG447 microglia chips (see above). 100 ng per samples of total RNA were used in nCounter analysis according to the manufacturer’s suggested protocol.
Butovsky O., Jedrychowski M.P., Cialic R., Krasemann S., Murugaiyan G., Fanek Z., Greco D.J., Wu P.M., Doykan C.E., Kiner O., Lawson R.J., Frosch M.P., Pochet N., Fatimy R.E., Krichevsky A.M., Gygi S.P., Lassman H., Berry J., Cudkowicz M.E, & Weiner H.L. (2014). Targeting miR-155 restores abnormal microglia and attenuates disease in SOD1 mice. Annals of neurology, 77(1), 75-99.
+ Open protocol
+ Expand
5

nCounter Gene Expression Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Details of the nCounter™ technology (NanoString Technologies, Seattle, WA) have been reported previously (Geiss et al., 2008 (link); Kulkarni, 2011 (link)). Briefly, NanoString designed and manufactured customized probes corresponding to the 42 genes in a previously reported prognostic signature (De Preter et al., 2010 (link)) (Table 1). A codeset specific to a 100-base region of the target mRNA was designed using a 3′ biotinylated capture probe and a 5′ reporter probe tagged with a specific fluorescent barcode; creating two sequence-specific probes for each target transcript. Probes were hybridized to 100 ng of total RNA for 19 hours at 65°C and applied to the nCounter ™ Preparation Station for automated removal of excess probe and immobilization of probe-transcript complexes on a streptavidin-coated cartridge. Data were collected using the nCounter™ Digital Analyzer by counting the individual barcodes.
Stricker T.P., Morales La Madrid A., Chlenski A., Guerrero L., Salwen H.R., Gosiengfiao Y., Perlman E.J., Furman W., Bahrami A., Shohet J.M., Zage P.E., Hicks M.J., Shimada H., Suganuma R., Park J.R., So S., London W.B., Pytel P., Maclean K.H, & Cohn S.L. (2014). Validation of a prognostic multi‐gene signature in high‐risk neuroblastoma using the high throughput digital NanoString nCounter™ system. Molecular Oncology, 8(3), 669-678.
+ Open protocol
+ Expand
6

Quantifying mRNA Transcripts in Myeloma

Check if the same lab product or an alternative is used in the 5 most similar protocols
For mRNA transcript counting the nCounter Human Cancer Reference Kit (cat.no GXA-CR1–12) and nCounter Technology (Nanostring Technologies, Seattle, WA, USA) was used. The standard mRNA Gene-expression experiment protocol provided by Nanostring was used, the only exception being that kit probes were diluted 1:2. Briefly, 100 ng total RNA from myeloma cell lines or patient samples was hybridized with reporter probes overnight at 65°C. The nSolver Analysis Software (Nanostring) was used for calculations of transcript numbers. Sample data was normalized against internal kit positive controls and the following housekeeping genes: CLTC, GAPDH, GUSB, HPRT1, PGK1, and TUBB.
Holien T., Misund K., Olsen O.E., Baranowska K.A., Buene G., Børset M., Waage A, & Sundan A. (2015). MYC amplifications in myeloma cell lines: correlation with MYC-inhibitor efficacy. Oncotarget, 6(26), 22698-22705.
+ Open protocol
+ Expand
7

Profiling Immune Signatures in FFPE Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was isolated from FFPE tissue sections using miRNeasy FFPE Kit (catalog no. 217504; Qiagen, Hilden, Germany) according to the manufacturer’s instructions and DNA was eliminated by means of Rnase-Free Dnase Set (catalog no. 79254; Qiagen, Hilden, Germany). mRNA expression was measured with the nCounter technology provided by NanoString Technologies. nCounter uses a molecular barcode technology, where the RNA is directly tagged with a target-specific capture probe and target-specific reporter probe containing a labeled barcode. Preparation and analyses were performed according to the manufacturer’s instructions using The PanCancer IO 360 gene expression panel which includes 770 immune-related genes and associated controls. Signatures were defined as previously described41 (link)–43 (link). Normalization was performed by the nSolver software, correcting for the expression of technical controls and 30 housekeeping genes included in the panel. Datasets have been deposited in the Gene Expression Omnibus with accession number GSE181597. Pathway scores were used to summarize data from a pathway’s genes into a single score. Cell type scores were calculated as the average log2 normalized expression of each cell’s marker genes.
Lodewijk I., Bernardini A., Suárez-Cabrera C., Bernal E., Sánchez R., Garcia J.L., Rojas K., Morales L., Wang S., Han X., Dueñas M., Paramio J.M, & Manso L. (2022). Genomic landscape and immune-related gene expression profiling of epithelial ovarian cancer after neoadjuvant chemotherapy. NPJ Precision Oncology, 6, 7.
+ Open protocol
+ Expand
8

Quantification of gene expression using nCounter

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
The mRNA expression levels of the target of interest LGALS1, as well as of the reference genes ACTB, GAPDH and PGK1, were quantified at the nCounter Core Facility on a SPRINT Profiler system by nCounter technology (NanoString Technologies (Seattle, WA, USA), as described previously [14 (link)]. Accession numbers and target sequences of analysed genes are:
LGALS1 gene (accession number NM_002305.4): GGTGCGCCTGCCCGGGAACATCCTCCTGGACTCAATCATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGA
ACTB gene (accession number NM_001101.2): TGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCT
GAPDH gene (NM_001256799.1): GAACGGGAAGCTTGTCATCAATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCTGAGTACGTCGTG
PGK1 gene (NM_000291.2): GCAAGAAGTATGCTGAGGCTGTCACTCGGGCTAAGCAGATTGTGTGGAATGGTCCTGTGGGGGTATTTGAATGGGAAGCTTTTGCCCGGGGAACCAAAGC
Ferreira T., Kulkarni A., Bretscher C., Nazarov P.V., Hossain J.A., Ystaas L.A., Miletic H., Röth R., Niesler B, & Marchini A. (2022). Oncolytic H-1 Parvovirus Hijacks Galectin-1 to Enter Cancer Cells. Viruses, 14(5), 1018.
+ Open protocol
+ Expand
9

RNP-IP of HuR-bound Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols
Panc-1 cells were plated and grown to ~65% confluency in T-150 flasks. For some samples, recombinant human soluble (s)TRAIL (ENZO) was added at 60 ng/mL for 1h prior to RNP-IP. RNA transcripts were immunoprecipitated from cell lysates with Protein A sepharose-bound anti-HuR Ab or non-specific IgG (MBL International, Woburn, MA), as previously described (30 (link)). The quantity of bound RNA was determined by RT-qPCR or measured using NanoString’s (Seattle, WA) nCounter technology.
Romeo C., Weber M.C., Zarei M., DeCicco D., Chand S.N., Lobo A.D., Winter J.M., Sawicki J.A., Sachs J.N., Meisner-Kober N., Yeo C.J., Vadigepalli R., Tykocinski M.L, & Brody J.R. (2016). HuR Contributes to TRAIL Resistance by Restricting Death Receptor 4 Expression in Pancreatic Cancer Cells. Molecular cancer research : MCR, 14(7), 599-611.
+ Open protocol
+ Expand
10

SARS-CoV-2 Detection in Adipose Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols
For each specimen, total RNA was extracted from four 10 µm-thick FFPE sections of abdominal WAT using the RNeasy FFPE kit (Qiagen, Hilden, Germany) and quantified by spectrophotometry (Trinean, Gentbrugge, Belgium). About 250 ng of RNA were used for each RT-PCR test to detect two genes of SARS-CoV-2 [viral nucleocapsid (N) and RNA-dependent RNA Polymerase (RdRp)] using the SARS-CoV-2 WE kit (Diatech Pharmacogenetics, Jesi, Italy). All samples were run in duplicate. Results were deemed positive when amplicons were obtained from at least one of the two genes. To evaluate the expression of viral nucleocapsid antigens and PKR by immunohistochemistry (IHC), 30 randomly selected high power (40x) fields were scanned, and the percentage of stained cells was calculated.
Gene expression analysis was performed by the nCounter technology (nanoString Technologies, Seattle, WA, USA) using two panels: (a) the Host Immune Response panel; (b) the Coronavirus panel plus that contains probes targeting the N and S ORFs of HCoV-229E, HCoV-HKU1, HCoV-NL63, HCoV-OC43, SARS-CoV, and the ACE2 virus receptor. Probes for the SARS-CoV-2 virus were designed according to the reference sequence, Wuhan-Hu-1 (NC_045512). For the assay, about 250 ng of RNA were hybridized with probes at 65 °C for 21 h. Procedures were performed following the manufacturer’s protocol.
Basolo A., Poma A.M., Bonuccelli D., Proietti A., Macerola E., Ugolini C., Torregrossa L., Giannini R., Vignali P., Basolo F., Santini F, & Toniolo A. (2022). Adipose tissue in COVID-19: detection of SARS-CoV-2 in adipocytes and activation of the interferon-alpha response. Journal of Endocrinological Investigation, 45(5), 1021-1029.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!