β actin

The RNAs were extracted from 1 × 10⁶ cells using the NucleoSpin^® miRNA kit (Macherey-Nagel #740971) in accordance with the manufacturer’s recommendations. Total RNA (500 ng) was reverse transcribed with the iScript cDNA Synthesis Kit^® (Bio-Rad #1708890). The cDNAs were diluted to 1/10th in RNase-free water. Real-time PCR was performed with SsoAdvanced™ Universal SYBR^® Green Supermix (Bio-Rad #1725272) and 250 nM of forward and reverse primers specific to the genes of interest, i.e., E-cadherin (cdh1), N-cadherin (cdh2), Vimentin (vim), Fibronectin (fn1), and to reference genes, i.e., β–actin (actb) and GAPDH (GAPDH) (Eurogentec, sequences of primers are available on request) in a CFX96 Touch^TM (Bio-Rad). Amplification was performed as follows: 5 min at 95 °C, 35 cycles (15 s at 95 °C and 60 s at 60 °C). PCR results were analysed using the 2^−ΔΔCt method.

The level of CYBB mRNA was quantified using two different primer pairs, compared with the level of the endogenous control, β-Actin (Eurogentec), and expressed as relative quantities compared with the WT cell line using the ΔΔCT method [21] (link). Primers used included gp91 exon 1 forward (CAACACATTCAACCTCTGCC), gp91 exon 3 reverse (GGACAGCAGATTTCGACAG), gp91 exon1-2 boundary forward (TTTTGTCATTCTGGTTTGGCTG), and gp91 exon 2-3 boundary reverse (CCAGTGCTGACCCAAGAAGT). Reactions were carried out in triplicate on an ABI StepOne Plus qPCR machine using SensiMix SYBR reagent (Bioline).

The total RNA was extracted with the NucleoSpin® RNA Plus Kit (Macherey-Nagel, Hoerdt, France) according to manufacturer’s instructions. Reverse transcription and real-time PCR were performed as previously described [56 (link)]. The following primers (Eurogentec, Liège, Belgium) were used: β-actin (forward 5′-CTCTTCCAGCCTTCCTTCCT-3′, reverse 5′-AGCACTGTGTTGGCGTACAG-3′); DDIT3 (forward 5′-TGGAAGCCTGGTATGAGGAC-3′, reverse 5′-AAGCAGGGTCAAGAGTGGTG-3′).
XBP1 splicing analysis was performed by end-point PCR as described previously [57 ] using the following primers (Eurogentec; forward: 5′- GGAGTTAAGACAGCGCTTGG -3′, reverse: 5′- ACTGGGTCCAAGTTGTCCAG -3′).