The largest database of trusted experimental protocols

Trizol reagent and reverse transcription kit

Manufactured by Thermo Fisher Scientific
Sourced in United States

TRIzol reagent is a ready-to-use solution for the isolation of total RNA from a variety of biological samples. The reverse transcription kit is used for the conversion of isolated RNA into complementary DNA (cDNA) for further analysis. Both products are designed for use in molecular biology applications.

Automatically generated - may contain errors

2 protocols using trizol reagent and reverse transcription kit

1

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The tissues and cells were extracted to RNA and then reversed to cDNA for conducting qRT-PCR assay by TRIzol reagent and reverse transcription kit (Invitrogen). Actin and U6 were used as reference genes for mRNA and miRNA, respectively. qRT-PCR analysis was evaluated by a CFX96 real-time PCR system with SYBR (TaKaRa, China). The relative expressions were calculated by using 2−ΔΔCt method. The primers are listed in Table 2.

The list of primers

NameForward/reverseSequence (5ʹ to 3ʹ)
CASC7FAACATGGTCTCTTGGTGCCTGATG
RCCACGGTAAGCGACGAGGAATC
miR-21-5pFGCTTATCAGACTGATGTTG
RGAACATGTCTGCGTATCTC
FASLGFTGCCTTGGTAGGATTGGGC
RGCTGGTAGACTCTCGGAGTTC
actinFCATGTACGTTGCTATCCAGGC
RCTCCTTAATGTCACGCACGAT
U6FCTCGCTTCGGCAGCACA
RAACGCTTCACGAATTTGCGT
+ Open protocol
+ Expand
2

Dendrimer-based Nanoparticle Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
A fourth-generation poly (amidoamine) dendrimer (G4.0 PAMAM)) was obtained from Chenyuan Molecular (Weihai, Shandong, China). 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[succinimidyl (polyethylene glycol)-2000] (DSPE-PEG2000-NHS) was obtained from Ponsure Biotechnology (Shanghai, China). The Cell Counting Kit 8 (CCK8), and Lyso-Tracker Green were supplied by Beyotime Biotechnology (Shanghai, China). The Alizarin Red Staining Kit was bought from Solarbio Science & Technology Co. (Beijing, China). Fluorescein isothiocyanate (FITC), Nile Red, Rhodamine B (Rho B), ALA, dimethyl sulfoxide (DMSO), and Streptozotocin (STZ) were purchased from Sigma-Aldrich (St. Louis, MO, USA). The collagen membrane was obtained from Geistlich Pharma AG (Wolhusen, Switzerland). AGE glycated bovine serum albumin (AGE-BSA) was bought from Abcam (Cambridge, MA, USA), Mino was purchased from AbMole Bioscience (Houston, TX, USA). Primary antibody for inducible nitrous oxide synthase (iNOS) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The TRIzol reagent and reverse transcription kit were bought from Invitrogen (Carlsbad, CA, USA) and Takara Shuzo (Kyoto, Japan). All other reagents and products for cell culture were bought from GIBCO (Gaithersburg, MD, USA) unless otherwise stated.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!