Agilent mx3005p qpcr system

Genomic DNA was extracted according to the LIVAK method [40 (link)] from individual An. gambiae s.l. mosquitoes from each site. TaqMan assays with two labelled fluorochromes probes FAM and HEX were used to screen for the L995F/S (previously referred to as L1014F/S) kdr mutations [7 (link)] and, the ace-1^R G280S (previously referred to as Ace1-G119S) mutation. Reactions were performed on the Agilent MX3005P qPCR system (Agilent Technologies). The genotype was determined from the fluorescence profiles and bi-directional scatter plots generated in the MX3005P software. The PCR condition was 95 °C for 10 min (1 cycle) following by 40 cycles of 95 °C at 10 s and 60 °C at 45 s, respectively.

Caco-2 monolayer cells were seeded in 6-well plates at the seeding density of 2.0 × 10⁵ cells/ml and cultured for 21 days. Afterward, probiotic V (10 μl), Met (1 mM), and ethanol (100 mM) were added according to their respective groups and incubated for 48 h. Cells were harvested using the TRIzol Reagent extraction method. Also, for in vivo studies, a total of 4 mg of colonic RNA was isolated from the colon tissue using the TRIzol Reagent extraction method. The concentrations (ng/μl) and purity (A260/A280) of extracted RNA were measured by a NanoDrop instrument (Thermo Fisher Scientific, Waltham, MA, USA). Extracted RNA was given a DNase treatment, and cDNA was synthesized from 1 μg of total RNA using a first-strand cDNA synthesis kit, according to the manufacturer's protocol. Real-time PCR amplification for quantifying the gene expressions was done using the SYBR/ROX Master Mix in an Agilent Mx3005P qPCR system (Agilent Stratagene) for the following primers (Tables 1 and 2). The respective gene expressions were normalized to the 18S rRNA gene expression (endogenous control). The quantification of results was done using the 2^−ΔΔCT method [35 (link)] and expressed as fold-over basal change comparative to the control group.

To validate the microarray data, the total RNA was reverse-transcribed using the Superscript® III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA, USA), and the cDNA was amplified with seven primers designed using Primer 3 software (version 4.0). Six genes (aicda, cyb5d1, edar, intl2, ogfr12 and tnfsf13b) and beta actin (endogenous control gene) were selected from the available sequences at GenBank. The gene accession numbers and primer sequences used for the quantitative real-time PCR are shown in Table C in S1 File. The SYBR Green-based quantitative real-time PCR was performed on an Agilent Mx3005P qPCR system (Agilent Technologies, Santa Clara, CA, USA). The reactions were performed using the Brilliant III Ultra Fast SYBR® Green QPCR Master mix (Agilent Technologies, Foster City, CA, USA) for one cycle of 95°C for 3 min followed by 40 cycles of 95°C for 10 s and 60°C for 20 s.
The relative quantification of gene expression was performed using the 2^∆∆Ct method [14 (link)]. The efficiencies of the PCR reactions for the genes were 90–110% under the optimized qPCR conditions, and the specificity of the primers was determined through melting-curve analysis [15 (link)]. Each amplification reaction was performed in triplicate.

The total RNA was extracted from the tibiae using the RNeasy Plus Universal Mini Kit (73404, Qiagen) according to manufacturer’s protocol. The tibiae were homogenized in a bullet blender in ice-cold QiaZol and with frozen bullets (three 32 mm and two 42 mm bullets). The RNA content was quantified with a NanoDrop. cDNA was synthesized using 1 μg RNA and the High Capacity cDNA Reverse Transcription kit (4368814, Applied Biosystem, Life Technologies). qPCR was performed using the Agilent Mx3005P qPCR System (Agilent Technologies, Santa Clara, CA) in a 20 μl reaction mixture containing 10 μl SYBR Green qPCR Master Mix (QUNT95074-012), 5 μl cDNA sample, 15 pmol of forward and reverse gene-specific primer-pairs (TagC, Denmark), and DNase-free water to a total volume of 20 μl. The specific sequences of the primer sets were: osteocalcin F: GCTCTGTCTCTCTGACCTCACA, osteocalcin R: TAGATGCGTTTGTAGGCGG, rpl13a: F: GGAGGGGCAGGTTCTGGTAT and rpl13a R: TGTTGATGCCTTCACAGCGT. The thermal profile was: initial denaturation at 95 °C for 30 s followed by 40 temperature cycles of 95 °C for 5 s, 60 °C for 15 s, and 72 °C for 10 s. The default cycle threshold (CT) value was used. Fold changes in mRNA expression levels were calculated according to the comparative CT method and normalized using the level of rpl13a mRNA as described previously^{29 (link)}.