Quikchange site directed mutagenesis system

The plasmids and primers used in this study were listed in Supplementary Table 2. In-frame gene deletion in P. aeruginosa PAO1 followed a previously published method (An et al., 2010 (link)). Briefly, the upstream and downstream homologous arms of the target gene were amplified by PCR using Pfu DNA polymerase (Vazyme, China) and ligated into pk18mobsacB which was pre-digested with BamHI and HindIII, generating the plasmids for target gene deletion. The resultant plasmid was transformed into PAO1 by tri-parental mating with the help of another plasmid pRK2013. Desired gene deletion mutants were screened on the LB agar plates supplemented with 10% sucrose. The mutants were confirmed by PCR and DNA sequencing.
For complementation, the open reading frames (ORF) or different domain regions of target genes were amplified and cloned into the plasmid pBBR1-MCS5. Point mutations in the complemented genes were constructed using the QuikChange site-directed mutagenesis system (Agilent, United States). All the constructs were transformed into PAO1 wild type or its mutants using the helper plasmid pRK2013 by triparental mating. The success of plasmid delivery into the PAO1 strains was verified by PCR. Stable expression of the FleS and FleR variants constructed in this study was confirmed by western blot (Supplementary Figure 1).

Plasmids employed in this study are listed in Supplementary Table 2. Coding sequences for rpfR, rpfR^GGAAF, rpfR^AAL, berA, and yedQ were subcloned into the broad-host-range cloning vector pBBR1MCS-5^{29 (link)} as follows: rpfR, rpfR^GGAAF, and rpfR^AAL as XbaI-HindIII fragments from pBBR-rpfR, pBBR-rpfR^GGAAF, and pBBR-rpfR^AAL, respectively, generating pRpfR^wt, pRpfR^GGAAF, and pRpfR^AAL; berA as a BamHI-XbaI fragment from pBBR2-Bcam1349, generating pBerA; and yedQ as a HindIII-BamHI fragment from pYhck, generating pYedQ. To generate pRpoN and pBerB, coding sequences together with the putative promoter region were PCR-amplified from genomic DNA using primer pairs P103/P104 and P280/P281, respectively, and cloned as XbaI-HindIII fragments into pBBR1MCS-5.
For heterologous expression, the rpfR gene was PCR-amplified using primers pQE-rpfR-F and pQE-rpfR-R, digested with BamHI and HindIII and cloned into pQE-32 digested with the same enzymes, giving rise to plasmid pQE-RpfR, which was transformed into E. coli M15[pREP4]. Point mutations were inserted into pQE32-rpfR by site-directed mutagenesis, using the QuikChange site directed mutagenesis system (Agilent)^{10 (link)}, generating plasmids pQE-RpfR^GGAAF and pQE-RpfR^AAL.

Myc-Che-1 has already been described [12 (link), 27 (link)]. pCI-HDAC 1 was a kind gift from Dr. Sartorelli, while pSG5 Large T (pSG5 SV40 LT) plasmid was a gift from William Hahn (Addgene plasmid #9053; http://n2t.net/addgene:9053; RRID: Addgene_9053). Myc-Che-1 3S and pSG5 SV40 LT 3S were generated by in vitro mutagenesis using the QuikChange site-directed Mutagenesis system (Agilent Technologies) following the manufacturer’s instructions. PCR reactions were achieved using the following primers:
Myc- Che-1 3S:

Forward 5′ - GCCCAATGCGGGAGGTGAGGAGATTGCTGGTGAAGATGATGAGC - 3′

Reverse 5′ - GCTCATCATCTTCACCAGCAATCTCCTCACCTCCCGCATTGGGC - 3′

pSG5 SV40 LT 3S:

Forward 5′ - AACCTGTTTTGCGCAGAAGAAATGCCAGCTGGTGATGATGAGGCT - 3′

Reverse 5′ - AGCCTCATCATCACCAGCTGGCATTTCTTCTGCGCAAAACAGGTT - 3′

All mutations were confirmed by sequencing realized by Eurofins Genomics.
Stealth siRNA oligonucleotides targeting Che-1 (siChe-1), CSNK2A (siCK2), control sequence (siControl) and custom Che-1 3’UTR (sense 5′-CCCGCCUUUAAACGCCACAAAUAAA-3′; antisense 5′-UUUAUUUGUGGCGUUUAAAGGCGGG-3′) were purchased from Thermo Fisher Scientific. TBB (4,5,6,7 – Tetrabromobenzotriazole) was purchased from SelleckChem. Casein kinase II (CK2 - P60105) recombinant protein and Adenosine 5′-triphosphate (ATP - P07565) were purchased from New England BioLabs.