Sybr fast qpcr kit master mix 2 universal

TRIZOL reagent was used to extract total RNA, and the cDNA Synthesis Kit from Yeasen Biotech was used to synthesize first-strand cDNA, following the manufacturer's instructions. RT-PCR was performed using the SYBR FAST qPCR Kit Master Mix (2×) Universal (Kapa Biosystems) on the ABI 7500 Real-time PCR Instrument (Life Technologies, CA, USA) in a 20 μl system. In addition, the SYBR FAST qPCR Kit Master Mix (2×) Universal (Kapa Biosystems) was utilized to perform RT-PCR on the ABI 7500 Real-time PCR Instrument (Life Technologies, CA, USA) in a 20 μl system. A total of 6 control samples and 8 UPJ samples were employed for RT-PCR. The following PCR primers were used: PAR1fw: 5′- TGCCTACTTTGCCTACCTCC -3′, PAR1rv: 5′- GTAGACGTACCTCTGGCAC -3′, PAR2fw: 5′- GCGATCTTCTGCCATGGATG -3′, PAR2rv: 5′- AGATCAGGTACATGGCCAGG -3′, GAPDHfw: 5′- GGAGTCAACGGATTTGGT -3′, GAPDHrv: 5′- GTGATGGGATTTCCATTGAT -3′. The relative changes in the expression levels of PAR1 and PAR2 were normalized against the levels of GAPDH gene expression in each sample using the ΔΔCt method. Each sample and primer were subjected to triplicate experiments. Furthermore, the relative mRNA expression levels of PAR1 and PAR2 in different Onen grades of preoperative hydronephrosis were investigated to explore their clinical implications.

RT-PCR was performed as previously described^{5 (link)}. For standard RT-PCR, total RNA was reverse transcribed with random hexamers for 1 h using AMV-RT (New England Biolabs), M-MLV RT (Promega) or Superscript III (Invitrogen). Strand-specific RT-PCR was performed using Superscript III RT (Invitrogen) or M-MLV RT (Promega). PCR was carried out using the resulting cDNA. For quantitative PCR (qPCR), SYBR Fast qPCR kit master mix (2×) universal (Kapa Biosystems, USA) was used with addition of ROX reference dye high and carried out on the Applied Biosystems 7900HT Fast Real-Time PCR system. Oligo sequences were reported previously^{5 (link)}. DIP1 Fw: 5′ TAATACGACTCACTATAGGGAGAAAGAAGTTGCGACAGAACCG 3′ and DIP1 Rv: 5′ TAATACGACTCACTATAGGGAGACGAACAGCTTGTAGATGGCA 3′. CamKII INE-1 Fw TGGGCTATTTTTAGGCGTCA, CamKII INE-1 Rv TATGAACGCGTCGATCTCAG, ey INE-1 Fw CGGAAAATGCCAAGGACTAA, ey INE-1 Rv GCTAAATGGGCACACTCGTC, INE-1 Fw GGCCATGTCCGTCTGTCC, INE-1 Rv AGCTAGTGTGAATGCGAACG, rox1 forward TGCAGTGGCAGTTTCTTCTG, rox1 reverse GGTCCGTGCAAAGCAGTAAT, rox2 forward TCTCCGAAGCAAAATCAAGC, rox2 reverse TGTTGCGTTCCAAGACACAT.

The cotyledons and first true leaves of 9110Gt and 9110G were flash frozen in liquid nitrogen and used for total RNA extraction using TRIzol^® (Thermo Fisher Scientific, Waltham, MA, USA). RNA was pretreated with RNase-free DNase I (Takara, Shiga, Japan), and first-strand cDNA was synthesized from 1.0 μg total RNA using reverse transcriptase SYBR FAST qPCR Kit Master Mix (2×) Universal (KAPA Biosystems, Wilmington, MA, USA).
Quantitative real time PCR (qPCR) was performed in a total volume of 10.0 μL which contained 1.0 μL of first-strand cDNA, 5.0 μL SYBR FAST qPCR Kit Master Mix, 0.4 μL gene-specific primers (10 μM·μL⁻¹), 0.2 μL ROX reference dye, and 3.4 μL ddH2O. Reactions were amplified in a ABI prism 7900 HT Real-Time PCR System with following conditions: pre-incubation at 95 °C for 3 min; 40 cycles of 95 °C for 30 s, 60 °C for 20 s; melting curves 95 °C for 15 s, 60 °C for 15 s, and 95 °C for 15 s. The 2^ΔΔCt method [66 (link)] was used to calculate relative changes in gene expression. All runs had three technical replicates and three biological replicates.