Truncated t4 rna ligase 2

HDMYZ cells were treated with 4-μg/ml ActD for 0, 1, 4 and 12 h. Small RNAs of 15–40 bases were gel-purified from 5-μg total RNA with 10% acrylamide gel (American Bioanalytical AB13021). Purified small RNA was subjected to library preparation, similar to Illumina protocol with modification. Briefly, pre-adenylated primer was made following a published protocol (29 (link)) using /5Phos/TGGAATTCTCGGGTGCCAAGG/3ddC/. Small RNA was ligated to the pre-adenylated primer with truncated T4 RNA ligase 2 (NEB M0242S). The 35–55 bases product was purified with 10% acrylamide gel and further went through a 5′ ligation reaction with primer: dGdTdTdCdAdGdAdGdTdTdCdTdAdCdA GUCCGACGAUC (Dharmacon) with T4 RNA ligase 1 (Fermentas EL0021). The 60–80 bases product was purified with 10% acrylamide gel and reverse transcribed with M-MLV reverse transcriptase (RT) (Invitrogen 28025–013) using primer: GCCTTGGCACCCGAGAATTCCA. The RT product was polymerase chain reaction (PCR) amplified for 18 cycles with Phusion DNA polymerase (NEB M0530) using a universal primer: AATGATACGGCGACCACCGAGATCTACACGTT-CAGAGTTCTACAGTCCGA and a specific primer for each sample (listed in Supplementary Table S4). 130–150-nt small RNA libraries were purified with 8% acrylamide gel. Barcoded small RNA libraries were sequenced on a HiSeq2000 (Illumina).

For the first screening of miRNA associated with the grass-clump dwarfism via small RNA sequencing, total RNA was extracted from crown tissues of WT and type II necrosis lines grown at normal temperature and 4°C under long-day (18-h light and 6-h dark) conditions for 8 weeks using Sepasol-RNA I Super G solution (Nacalai Tesque, Kyoto, Japan). For each sample, crown tissues of at least two independent plants were bulked with no biological replications. Small RNA libraries were prepared using a TruSeq Small RNA Library Preparation Kit (Illumina, San Diego, CA, USA) and RNA 3’ adapter and RNA 5’ adapter were respectively added using truncated T4 RNA ligase 2 (New England BioLabs, Ipswich, MA, USA) and T4 RNA ligase 1 (New England BioLabs). cDNA was synthetized using the 3’ adapter-recognizing primer, and after PCR, products of around 150 bp were selected. Single-end sequencing was performed with a TruSeq SBS Kit v3-HS (Illumina) on a HiSeq2000 platform (Illumina) according to the manufacturer’s instructions. Files containing raw sequence data were deposited in the sequence read archive of DDBJ (accession number DRA004554).

Turbo DNase-treated total RNAs were incubated with RNase H (New England Biolabs) in the presence or absence of oligo(dT)_12–18. The resulting RNAs were ligated with a 3′ linker, containing a blocked 3′ (ddC) end and an activated adenosine at the 5′ end using truncated T4 RNA ligase 2 (New England Biolabs). RNAs were then purified using a NucleoSpin miRNA kit (Macherey-Nagel) to remove free 3′ linker oligos, followed by reverse transcription using RT-primer that anneals to the 3′ linker sequence. cDNAs were purified with Agencourt AMPure XP beads (Beckman Coulter). The first PCR step was performed with only a gene-specific sense primer for 30 cycles, second PCR amplification was performed with nested sense primer labelled at the 5′ end with [γ-³²P]ATP using T4 polynucleotide kinase (New England Biolabs) and reverse primer annealing to the 3′ linker. Primers are listed in the Supplementary Table 2 (^# indicates primers labelled with ³²P). The resulting PCR products, as well as a 50-bp DNA ladder (Life Technologies) labelled with [γ-³²P]ATP, were loaded on 6% acrylamide gels (SequaGel UreaGel System, National Diagnostics). The gel was then placed on a piece of Whatman filter paper, dried under vacuum and heat (80 °C), exposed and scanned on a Fujifilm Image Reader (Fujifilm FLA 7000).