We used TRIzol reagent to extract total RNA from the collected samples (cells). The concentration, purity, and integrity of the collected total RNA were evaluated by a UV spectrophotometer and agarose gel electrophoresis. Subsequently, reverse transcription of cDNA was performed using a high capacity cDNA kit (Applied Biosystems, USA). The RNA sample of 1 µg was used together with random primers during the synthesis process. The amplification process was performed using a one-step SYBR PrimeScript RT-PCR kit and an ABI 7500 PCR system. The amplification protocol and conditions were followed according to the instructions provided with the kit. PCR amplification was performed for 40 cycles, with each sample repeated in three wells, and the entire experiment was replicated three times. In this study, GAPDH was used as the internal mRNA reference. We used the 2-△△ct method for data analysis. The primer sequences are shown in Table 1
Sybr prime script rt pcr kit
Manufactured by Thermo Fisher Scientific
Sourced in United States
The SYBR® Prime Script™ RT-PCR Kit is a laboratory reagent designed for reverse transcription and real-time PCR amplification. It includes all necessary components for performing these tasks.
Automatically generated - may contain errors
Lab products found in correlation
Transcriptor first strand cdna synthesis kit, by Roche (3 mentions)
Trizol reagent, by Thermo Fisher Scientific (3 mentions)
Revertaid h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Mirna first strand cdna synthesis kit, by Sangon (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
High capacity cdna kit, by Thermo Fisher Scientific (1 mentions)
7500 pcr system, by Thermo Fisher Scientific (1 mentions)
Prism 7900 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Thermo Fisher Scientific (1 mentions)
Trizol total rna reagent, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500 fast, by Thermo Fisher Scientific (1 mentions)
Rnase free dnase, by Promega (1 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Nanodrop 8000, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Abi 7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Primescript rt, by Takara Bio (1 mentions)
15 protocols using sybr prime script rt pcr kit
1
RNA Extraction and qRT-PCR Analysis
2
Quantitative RT-PCR Analysis of Liver Transcripts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from liver tissues using the TRIzol method. The A260/280 ratio was in the range of 1.8-2.0 and RNA integrity was verified by agarose gel electrophoresis. cDNA was synthesized by reverse transcribing 4 μg of total RNA in a final reaction volume of 20 μL using a First-Strand cDNA Synthesis Kit, according to the manufacturer's instructions. Primer oligonucleotide sequences specific for quantitative real-time PCR (qPCR) are shown in Table 1 and were designed and synthesized by Sangon Biotech Inc. (Shanghai, China). qPCR was conducted using the SYBR PrimeScript RT-PCR Kit, following the manufacturer's protocol, on an ABI Prism 7900 Sequence Detection System. The PCR mixtures contained 1 μL cDNA, 10 μL SYBR Premix Ex Taq 2 ×, and 0.25 μM forward and reverse primers, in a final volume of 20 μL. Triplicate reactions were performed, starting with a polymerase activation step for 10 sec at 95°C and followed by 40 cycles of 5 sec at 95°C and 20 sec at 60°C. Fluorescence data were acquired after each cycle and β-actin was used as an endogenous control to calculate relative quantitative gene expression values. The absence of primer dimers and unspecific products was verified after every run by a melting curve analysis (72-95°C) and agarose gel electrophoresis.
3
Transcriptional Profiling of Soybean Roots
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted from soybean roots using a Plant RNA Extraction Kit (Thermo Fisher). The cDNA was synthesized from total RNA (1 µg) using the PrimeScript RT Reagent Kit (Thermo Fisher, Waltham, MA, USA), and qRT-PCR was performed using the SYBR PrimeScript RT-PCR Kit (Thermo Fisher, Waltham, MA, USA). The GmACTIN2 was used as the internal control. Fold changes (2−ΔΔCt) were expressed relative to the control. The primer sequences used in this study are listed in Table S5 .
4
Quantifying mRNA and lncRNA Expressions in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from CRC tumor tissues, matched adjacent normal tissues, and CRC cells using TRIzol® Total RNA reagent (Thermo Fisher Scientific). Complementary DNA (cDNA) synthesis was performed with 2 μg total RNA using the RevertAid™ H Minus First Strand cDNA synthesis kit (Thermo Fisher Scientific). The primers were obtained from Sangon biotech (Shanghai, People’s Republic of China), and the sequences are shown in Table 1 .
Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using the SYBR® PrimeScript™ RT-PCR kit (Thermo Fisher Scientific) in a 7500 Fluorescent qPCR System (Thermo Fisher Scientific). The reaction mixtures were incubated at 95°C for 30 seconds, followed by 40 amplification cycles of 95°C for 5 seconds and 60°C for 34 seconds. The comparative ΔCt method was used to quantify relative expression of mRNA and lncRNA. Expression level of housekeeping gene β-actin was used to normalize gene-of-interest expression. The expression level of a gene in a patient was calculated as the ratio of target in tumor tissue/target in nontumorous tissue (R [C/N]).
Real-time quantitative polymerase chain reaction (RT-qPCR) was performed using the SYBR® PrimeScript™ RT-PCR kit (Thermo Fisher Scientific) in a 7500 Fluorescent qPCR System (Thermo Fisher Scientific). The reaction mixtures were incubated at 95°C for 30 seconds, followed by 40 amplification cycles of 95°C for 5 seconds and 60°C for 34 seconds. The comparative ΔCt method was used to quantify relative expression of mRNA and lncRNA. Expression level of housekeeping gene β-actin was used to normalize gene-of-interest expression. The expression level of a gene in a patient was calculated as the ratio of target in tumor tissue/target in nontumorous tissue (R [C/N]).
5
Relative Gene Expression in Transgenic Plants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from leaf tissue of transgenic and non-transgenic plants using the RNeasy Mini Kit (Qiagen) following the manufacturer's instructions and treated with RNase free-DNase (Promega). The RNA samples were PCR-tested for genomic DNA cross-contamination. RNA quality and concentration were assessed by gel electrophoresis and spectrophotometry (NanoDrop 8000 -Thermo Scientific). cDNA was synthesized from 1 µg total RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) using Oligo(dT)15. The relative expression values were analyzed using the SYBR Prime Script RT-PCR kit (Thermo Scientific) in ABI PRISM 7500 Fast (Applied Biosystems) and were determined by the ΔΔCt method (Livak and Schmittgen, 2001) . Expression values were normalized by the endogen cyclophilin for C. sinensis and by the gene ARPC3 (Actin-related protein C3) for tobacco. The primers used for RT-qPCR are listed in Table S1. Assays were performed in triplicates and statistical significance of the means calculated according to Tukey's test (* p < 0.05).
6
Quantifying Tomato Gene Expression with qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The different tomato lines were detected by quantitative real-time PCR with the use of specific primers and probes. They included the aff lines BA-130, BA-150, 06-790, and 09-1225, the WT lines BA-124, BA-128, LA4069, and H1706, and the F1 progeny from the crossing of 06-790 and H1706. Plants were grown in the greenhouse in the autumn of 2017, and RNA was collected from locule tissues at 7, 10, 15, and 25 DAF, with three samples taken per line. SlFRG27 (Solyc06g007510), SlFRG03 (Solyc02g063070), and ACTIN (Solyc11g005330) were selected as the reference genes, and the primer sequences are listed in Supplementary Table S2 (Cheng et al., 2017 (link)). The primer sequence of AFF was F (5´–3´), GCATCTGGTTGGTGAAGG; R (5´–3´), ATCTGATTCTGCTGATGCC. The primers were designed using the Roche LCPDS2 software and synthesized by Beijing TsingKe Biological Technology Co., Ltd. cDNA was obtained from total RNA by reverse-transcription using a PrimeScript RT reagent kit (TaKaRa). The qRT-PCR was conducted on a Prism®7900 qRT-PCR operating system (Applied Biosystems), according to the instructions of the SYBR Prime Script RT-PCR kit. The 2–ΔΔCT method was used to determine the expression of the genes.
7
Real-Time qPCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using TRIzol Reagent. First‐strand cDNA was synthesized from 3 μg of total RNA using SuperScript II reverse transcriptase (Invitrogen, Thermo Fisher Scientific). To detect mRNA expression, we selected gene‐specific primers based on the nucleotide sequence of the cDNA. QRT‐PCR analyses of the targeted mRNA were performed using the SYBR Prime Script RT‐PCR Kit with an ABI 7500 Real‐Time PCR System (Applied Biosystems). Reaction conditions were as follows: an initial step at 95°C for 30 seconds, followed by 40 cycles of denaturation at 95°C for 5 seconds, annealing at 60°C for 10 seconds, and extension at 72°C for 35 seconds. β‐actin was used as an internal standard to control for amplification variability due to differences in starting mRNA concentrations. The threshold cycle (Ct) was defined as the fractional cycle number. The gene expression level was expressed relative to that of β‐actin and the delta (delta Ct) method was used to calculate the fold change for each sample.
8
Quantifying Tomato Gene Expression Patterns
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
With the use of specific primers and probes, different tomato lines were detected by real-time PCR. They included all-flesh tomato lines BA-130, BA-150, 06-790, and 09-1225, normal tomato lines BA-124, BA-128, LA4069 and H1706, and F1 progeny from the crossing of 06-790 and H1706. They were grown in the greenhouse in autumn 2017, and RNA was collected from locule tissues at 7 DAF, 10 DAF, 15 DAF and 25 DAF. The internal reference gene was SIFRG27 in tomato, the locus was Solyc06g007510, and the primer sequence was F (5'-3'): CTCTCTGTTGACAGACCCA; R (5'-3'): GAGTCCAGCTACGAGCAGTG (Cheng et al., 2017) .
The primer sequence of AFF was F (5'-3'): GCATCTGGTTGGTGAAGG; R (5'-3'):
ATCTGATTCTGCTGATGCC. The primers were designed by Roche LCPDS2 software and were synthesized by Beijing TsingKe Biological Technology Co., Ltd. cDNA was obtained from total RNA by using Prime script RT, the reverse transcription kit of Takara Bio Inc. The qRT-PCR was completed on an ABI Prism®7900 qRT-PCR operating system of Applied Biosystems, according to the instructions of the SYBR Prime script RT-PCR kit. The qRT-PCR and 2 -ΔΔCt method were used to analyze the expression of the selected gene.
The primer sequence of AFF was F (5'-3'): GCATCTGGTTGGTGAAGG; R (5'-3'):
ATCTGATTCTGCTGATGCC. The primers were designed by Roche LCPDS2 software and were synthesized by Beijing TsingKe Biological Technology Co., Ltd. cDNA was obtained from total RNA by using Prime script RT, the reverse transcription kit of Takara Bio Inc. The qRT-PCR was completed on an ABI Prism®7900 qRT-PCR operating system of Applied Biosystems, according to the instructions of the SYBR Prime script RT-PCR kit. The qRT-PCR and 2 -ΔΔCt method were used to analyze the expression of the selected gene.
9
Quantifying MDR1 Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The relative expression level of MDR1 was measured by quantitative real‐time PCR. The TRIzol Reagent Kit (Takara, Otsu, Japan) was applied to isolate total RNA, and the miRNA First Strand cDNA synthesis kit (Sangon Biotech, Shanghai, China) was applied to transcribe RNA into cDNA. Quantitative real‐time PCR was performed with SYBR® Prime Script™ RT‐PCR Kit (Invitrogen). The primer sequences were as follows: MDR1 forward: 5′‐CCCATCATTGCAATAGCAGG‐3′, reverse: 5′‐ TGTTCAAACTTCTGCTCCTGA‐3′; GAPDH forward: 5ʹ‐GTCTCCTCTGACTTCAACAGCG‐3ʹ, reverse: 5ʹ‐ACCACCCTGTTGCTGTAGCCAA‐3ʹ. The Mx3000P real‐time PCR system (Thermo Fisher) was used. The PCR conditions were described as follows: 95 °C for 15 min and then 40 cycles of 94 °C for 15 s, 60 °C for 1 min and 72 °C for 1 min. All procedures were conducted in triplicate. The 2−ΔΔCt method was used to calculate the relative MDR1 expression.
10
Quantifying miRNA and mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cells using TRIzol® reagent (Thermo Fisher Scientific, Inc.) and reverse-transcribed into cDNA with a cDNA Synthesis Kit (Sangon Biotech Co., Ltd.) according to the manufacturer's protocol. RT-qPCR was conducted with a SYBR Prime Script RT-PCR kit (Invitrogen; Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 10 min at 95˚C; 40 cycles of 1 min at 95˚C, 2 min at 63˚C and 1 min at 72˚C. The primers were synthesized by Sangon Biotech Co., Ltd. The miRNA relative expression was calculated by normalizing to U6 small nuclear RNA. The primer sequences were as follows: miR-490-3p forward, 5'-CGTGGATCCTTCTTCA ACCAACGGTGGTG-3' and reverse, 5'-CCAGAATT CAAAGCAGGAAGAGTAAGACTTCC-3'; IRAK1 forward, 5'-CCTCCAGGTTCCACTCTCTG-3' and reverse, 5'-AACCACCCTCTCCAATCCTG-3'; TRAF6 forward, 5'-TTGCACATGAGACTGTTGGC-3' and reverse, 5'-CTTCGAATGGTCCGCTTGAG-3'; GAPDH forward, 5'-AACGGATTT GGTCGTATTG-3' and reverse, 5'-GGAA GATGGTGATGGGATT-3'; U6 forward, 5'-GGAGCGAG ATCCCTCCAAAAT-3' and reverse, 5'-GGCTGTTGTCAT ACTTCTCATGG-3'. Relative expression was calculated using the 2-ΔΔCq method (19 (link)), using U6 or GAPDH as normalization controls.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!