Lgk974

Recombinant WNT5B and MTX were purchased from Bio‐Techne Corporation (Minneapolis, MN, USA). D10 antibody was provided by Oncternal Therapeutics, Inc. LGK‐974 (a pan‐WNT inhibitor that inhibits the secretion of all 19 WNT ligands) purchased from MedChemExpress (Monmouth Junction, NJ, USA). pX330‐U6‐Chimeric_BB‐CBh‐hSpCas9 was a gift from Feng Zhang (Addgene plasmid # 42230; http://n2t.net/addgene:42230; RRID:Addgene_42230).
¹² (link)

The negative control (NC), BRF2 small interfering (si) RNA, BRF2 overexpression plasmid (OE), miR‐409‐3p inhibitor, and miR‐409‐3p mimics were all purchased from Gene Pharma (Shanghai, China). LGK974 was obtained from MedChemExpress (Monmouth Junction, NJ, USA). Huh-7 cells were plated into 6‑well plates at a density of 1 × 10⁵ cells per well and cultured for 24 h until they reached 80% confluency. The medium was then replaced with 1.5 mL fresh DMEM without antibiotics or antimycotics. Transfections were performed by mixing Lipofectamine 2000 (Invitrogen, Rockford, IL, USA), 100 pmol siRNA (NC or BRF2), miR‐409‐3p inhibitor, or miR‐409‐3p mimic, and OptiMEM (Thermo Fisher Scientific, Rockford, IL, USA). This mixture was incubated with Huh-7 cells for 6 h. The medium was then discarded and replaced with DMEM with 10% FBS. The targeting sequences were as follows: BRF2 siRNA, GCACUUACAUGCAGAUAGUTT; siRNA‑NC, UUCUCCGAACGUGUCACGUTT; miR‐409‐3p inhibitor, AGGGGUUCACCGAGCAACAUUC; miR‐409‐3p mimic, GAAUGUUGCUCGGUGAACCCCUGGGUUCACCGAGCAACAUUCUU. Cells were collected for protein and RNA analysis 12 h after transfection.