Genmute reagent

A custom CRISPR kit for ACADVL c.65C > A p.(Ser22^∗), CRISPR pCas-Guide-EF1a-GFP, NM_001033859.2 (ACADVL): c.65C > A p.(Ser22^∗), was used. The modified sequence was (ACCGGGCCGGCACTGAACCCCACTCCCCACAGCT[A]GC GGCTCACGGCGCTCCTGGGGCAGCCCCGGCCCG) in pCas-Guide-EF1a-GFP. For transfection, GenMute Reagent (Cat #SL100568, SignaGen, Rockville, MD, United States) was used. Normal cells (200,000 cells) were inoculated in a T25-flask in 10% FBS at 37°C overnight. On the next day, the cells were starved with 1% FBS for 24 h. On day 3, the VLCAD mutation was introduced into normal cells (Hs27) using GenMute Reagent and the CRISPR kit. The GenMute Transfection working solution was prepared by adding the CRISPR construct with the mutation. A second working solution was also prepared using normal DNA as a control. All flasks were incubated for 4 h at 37°C after transfection. Then, media were replaced with fresh Advanced RPMI 1640 conditioned medium, which was also used in the isolation step.

The full-length and truncated TPR plasmids (Flag-TPR) were obtained from GeneChem (Shanghai, China). The plasmids were transfected into 293 T cells with GenJet™ Plus reagent (SignaGen Laboratories, Maryland, USA). Specific small interfering RNA (siRNA) targeting TPR was purchased from Santa Cruz (sc-45,343). The transient transfection of siRNA was performed using Genmute™ Reagent (SignaGen Laboratories, Maryland, USA) according to the manufacturer’s instructions.

The plasmids were designed and synthesized by GenePharma Company (Shanghai, China). The siRNA was designed and constructed by Wuhan Biological Company (Wuhan, China). According to the manufacturer’s protocol, siRNA was transfected using Genmute reagent (SignaGen Laboratories, MD, USA). Lipo3000 (Invitrogen, Waltham, Massachusetts, USA) was used for plasmid transfection according to the manufacturer′s instructions. The lentiviruses carrying shRNA were packaged by Gene Create Company (Wuhan, China). HCC cells were transduced with a lentivirus. After 48 h of infection, puromycin (2 μg/mL) was added to the medium to select positively infected cells. The siRNA and shRNA sequences are shown in Supplementary Table S3.

For transfection treatment, HCG-27 and AGS cells were seeded in a 6 cm dish 24 h before transfection with the siRNA-negative control (NC) and ELOVL4-siRNA groups. Cells were treated with 5 µl of siRNA, and GenMute™ Reagent provided by SignaGen Laboratories (Baltimore, USA) was diluted in dilute GenMute™ Transfection Buffer working solution (1x) for 5 min. The samples were then mixed and incubated at room temperature for 15 min before being added to a cell culture plate. After transfection for 48-72 h, the cells were collected for subsequent experiments. Two siRNA specific for ELOVL4 were used in this study, with the following sequences: siNC: UUCUCCGAACGUGUCACGUTT, ACGUGACACGUUCGGAGAATT; siELOVL4-1: GGACAUACAAAGAGCCUAATT, UUAGGCUCUUUGUAUGUCCTT; siELOVL4-2: GUCUAGUGCUCAUUAUCUATT, UAGAUAAUGAGCACUAGACTT.