Dichloran rose bengal chloramphenicol agar

The isolation of fungal cultures from collected
bread samples was performed by spreading the direct plating method
using Dichloran Rose Bengal Chloramphenicol agar (Merck, Darmstadt,
Germany) and Dichloran 18% Glycerol agar (Merck, Darmstadt, Germany).
Purification was performed with malt extract agar, including 20 g/L
glucose (Merck, Darmstadt, Germany). For their molecular identifications,
DNA was extracted with Biospeedy Fungal DNA kit according to the instructions
of the manufacturer. Molecular identification was carried out by amplifying
the internal transcribed spacer region (ITS) using ITS1-5.8S rRNA
and ITS2 (5′TCCTCCGCTTATTGATATGC3′) as forward and (5′GGAAGTAAAAGTCGTAACAAGG3′)
as reverse primers for real-time polymerase chain reaction (QPCR).
QPCR amplification was performed under the following conditions: initial
denaturation at 95 °C for 10 min, 45 cycles at 95 °C for
15 s, 53 °C for 20 s, and final extension at 98 °C for 40
s. QPCR products were purified using the PCR Purification Kit following
the manufacturer’s instructions. Sanger Dideoxy Sequence Termination
Method using ABI Prism 377 DNA Sequencing Analyzer (Applied Biosystems,
ABD) was used to analyze DNA sequences. Sequences for the 18S and
ITS region were compared with the sequences available in National
Center for Biotechnology Information (NCBI) using the online BLAST
tool.⁹⁴

The microbiological evaluation was performed on days 0, 3, 6, 9, and 12 of the storage period. Twenty-five g of chicken samples were mixed in sterile lab-blender (Neutec, Paddle Lab Blender, Farmingdale, NY, USA) with 225 mL of peptone water (0.1% w/v; Difco, Becton Dickinson, East Rutherford, NJ, USA) for 3 min. Serial dilutions were prepared with 0.1% peptone water. PCA (Plate Count Agar, Merck, Darmstadt, Germany), VRB (Violet Red Bile Agar, Merck, Darmstadt, Germany) and DRBC (Dichloran Rose-Bengal Chloramphenicol Agar, Merck, Darmstadt, Germany) were employed as nutrient broths for the enumeration of total viable counts (TVC), coliform, mold, and yeast counts, respectively, by pour plate technique. TVC, coliform, mold, and yeast were incubated for 48–72 h at 30 °C, 24 h at 37 °C, and 5 days at 25 °C, respectively. The results were reported as Log10 colony forming unit/g (Log CFU/g) of chicken samples [36 ].

The total aerobic mesophilic count (TAMC), total yeast count (TYC), and total mould count (TMC) were analysed in the fresh, untreated juice and in the juices subjected to processing (HHP, LPT, and HTP) upon storage at 6 ± 2°C for periods of 0, 7, and 14 days.
A sample of juice (10 mL) was diluted with 90 mL of saline peptone (SP, 1 g/L peptone, 8.5 g/L NaCl) and homogenized in a stomacher (Model 400, Seward, London, UK) at a regular speed for 2 min.
To determine the TAMC of the juice samples, the homogenates were serially diluted and plated on plate count agar (Merck, No. 105463), followed by incubation at 30 ± 1°C for 3 days. Mould and yeasts were determined by plating the homogenates in dichloran rose bengal chloramphenicol agar (Merck, No. 100466), followed by incubation at 25 ± 1°C for 5 days.
After incubation, the plates were counted, and the results were expressed as colony-forming units per 1 mL (CFU/mL). The determinations were carried out in triplicate. The detection limit was <1 CFU/mL.

Samples of 10 g were taken at random for each batch, and aseptically weighed into a sterile stomacher bag with 90 mL of sterile buffered 0.1% (m/V) peptone water (Sigma-Aldrich, Saint Louis, USA) and homogenized for 1 min in a 400 Stomacher (Seward Ltd., Worthing, UK). Serial decimal dilutions were made, and lactic acid bacteria were determined by plate count on de Man, Rogosa and Sharpe agar (MRS; Oxoid, Basingstoke, UK) after incubation at 30 °C for 120 h. The number of yeast and mould colonies was determined by plate count on Dichloran Rose Bengal Chloramphenicol (DRBC) agar (Sigma-Aldrich, Merck, Saint Louis, MO, USA) after incubation at 25 °C for 120 h, and total count of mesophilic bacteria was determined on plate count agar (PCA, Sigma-Aldrich, Merck, Saint Louis, MO, USA) after incubation at 30 °C for 72 h in a thermostat. After incubation, colonies were counted according to ISO 7218:2007 (29 ). The microbiological data were transformed into the logarithm of the number of colony forming units (CFU/g).