Hs cdc42 7 flexitube sirna

For silencing CDC42, sixty percent confluent HUVECs were transfected for 6 h with 20nM CDC42 siRNA (Hs_CDC42_7 FlexiTube siRNA, Qiagen) or Scrambled, in a solution of Lipofectamine^™ RNAiMAX (invitrogen) according to manufacturer’s instructions. Expression levels of CDC42 were assessed by Real time PCR (qScript^™ cDNA SuperMix, Quanta Bioscience for cDNA synthesis, and QuantiTect SYBR Green PCR Kit, Qiagen for PCR reaction) and by antibody staining (mouse anti-CDC42, Clone 44, BD Biosciences). GAPDH primers used: Fw (5′-3′) GTCTCCTCTGACTTCAACAGCG and Rv (3′-5′) ACCACCCTGTTGCTGTAGCCAA). Human CDC42 primers used: Fw (5′-3′) TGACAGATTACGACCGCTGAGTT and Rv (3′-5′) GGAGTCTTTGGACAGTGGTGAG). Channels within molds were seeded with transfected HUVECs and either left in culture for apoptosis and sprouting assay, or implanted in vivo in a model of hind limb ischaemia. Active caspase 3 (Rb pAb, Abcam ) staining was used to determine the percentage of apoptotic cells within channels. The growth of angiogenic sprouts from patterned vessels was tested after a four day culture in fibroblast conditioned media-EGM2 medium (1:1), followed by fixation in 4% PFA for 30 min and phalloidin (Invitrogen) staining for 1h.