M mlv reverse transcriptase kit with random primers

Total RNA was isolated using TRIzol Reagent (Invitrogen) and purified using RNA Clean & Concentrator Kits (Zymo Research). 1 μg of total RNA was used to synthesize cDNA using the M-MLV Reverse Transcriptase Kit with Random Primers (Invitrogen). Gene specific primers targeting 18S RNA (forward:AACCCGTTGAACCCCATT, reverse:CCATCCAATCGGTAGTAGCG) or the SARS-CoV-2 N gene (forward: TTACAAACATTGGCCGCAAA, reverse: GCGCGACATTCCGAAGAA) and Power SYBR Green PCR Master Mix (Applied Biosystems) were used to amplify cellular RNA and viral RNA by QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems). The relative expression levels of SARS-CoV-2 N gene was calculated using the standard curve method and normalized to 18S ribosomal RNA as an internal control.

Total RNA was isolated using TRIzol Reagent (Invitrogen) and purified using RNA Clean & Concentrator Kits (Zymo Research). 1 µg of total RNA was used to synthesize cDNA using the M-MLV Reverse Transcriptase Kit with Random Primers (Invitrogen). Gene specific primers targeting 18 S RNA (forward:AACCCGTTGAACCCCATT, reverse:CCATCCAATCGGTAGTAGCG) or the SARS-CoV-2 N gene (forward: TTACAAACATTGGCCGCAAA, reverse: GCGCGACATTCCGAAGAA) and Power SYBR Green PCR Master Mix (Applied Biosystems) were used to amplify cellular RNA and viral RNA by QuantStudio 6 Flex Real-Time PCR Systems (Applied Biosystems). The relative expression levels of SARS-CoV-2 N gene was calculated using the standard curve method and normalized to 18 S ribosomal RNA as an internal control.