Superscript 3 first strand synthesis system for rt

Manufactured by Thermo Fisher Scientific

The SuperScript III First-Strand Synthesis System for RT is a laboratory equipment product designed for the reverse transcription of RNA into cDNA. It provides the necessary reagents and enzymes to facilitate this process, which is a fundamental step in various molecular biology and genomics applications.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (2 mentions) Rneasy micro kit, by Qiagen (1 mentions) Steponeplus, by Thermo Fisher Scientific (1 mentions) Rnalater, by Qiagen (1 mentions) Thunderbird probe qpcr mix, by Toyobo (1 mentions)

Close spelling variants of this product

SuperScript III First-Strand Synthesis System for RT-qPCR SuperScript III First-Strand cDNA synthesis system for RT-PCR Superscript R III first-strand synthesis system for RT-PCR Superscript III First-Strand Synthesis System for real-time PCR (RT–PCR) SuperScript III Transcriptor First Strand cDNA Synthesis System for RT-PCR Invitrogen SuperScript® III First-Strand Synthesis System for RT-PCR SuperScript III First-Strand Synthesis System for RT-PCR SuperScript III First-Strand Synthesis System for RT-PCR kit reagent SuperScript III First-Strand Synthesis System for RT-PCR kit Superscript III First Strand Synthesis System for RT-PCR kit with oligo (dT) primers

3 protocols using superscript 3 first strand synthesis system for rt

Quantifying Nrf2-mediated Antioxidant Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from hippocampal tissue from all groups (A–I) using TRIzol reagent (Invitrogen, UK). Reverse transcription was performed with 1 ng RNA using SuperScript III First-Strand Synthesis System for RT (Invitrogen). Real-time PCR was performed using TaqMan gene expression assays for the following genes: Nrf2 (encoding for nuclear factor erythroid 2-related factor 2 [NRF2]); Nqo1 (encoding for NAD(P)H: quinone oxidoreductase 1); Hmox-1 (encoding for haem oxygenase 1); and Sod2 (encoding for superoxide dismutase 2). All samples were performed in triplicate and normalised to the housekeeping genes Actb and Ppia. Values are expressed as a fold-change relative to group A (WT-EE) for STZ-diabetic mice and group G (Nrf2^−/−-EE) for Nrf2^−/− mice.

McNeilly A.D., Gallagher J.R., Evans M.L., de Galan B.E., Pedersen-Bjergaard U., Thorens B., Dinkova-Kostova A.T., Huang J.T., Ashford M.L, & McCrimmon R.J. (2023). Chronic hyperglycaemia increases the vulnerability of the hippocampus to oxidative damage induced during post-hypoglycaemic hyperglycaemia in a mouse model of chemically induced type 1 diabetes. Diabetologia, 66(7), 1340-1352.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression in IL-6Ra KD Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from brain regions (hippocampus, frontal cortex, cerebellum and hypothalamus), pancreas and liver from male IL-6Ra KD and Cre^+/- mice using TRIzol® reagent (Invitrogen). Reverse transcription was performed with 1 ng RNA using SuperScript® III First-Strand Synthesis System for RT (Invitrogen). Real-time PCR was performed using Taqman gene expression assays for IL-6ra (Mm01211445_m1), Socs3 (Mm00545913_s1) and Igfbp1 (Mm00515154_m1). All samples were performed in triplicate and normalised to Cyclophilin A (Ppia; Mm02342430_g1) or actin (Mm02619580_g1). Values are expressed as a fold-change relative to Cre^+/-.

McNeilly A.D., Yianakas A., Gallagher J.G., Tarlton J., Ashford M.L, & McCrimmon R.J. (2022). Central deficiency of IL-6Ra in mice impairs glucose-stimulated insulin secretion. Molecular Metabolism, 61, 101488.

+ Open protocol

+ Expand

Isolation and Analysis of Mouse Taste Buds

Check if the same lab product or an alternative is used in the 5 most similar protocols

Taste buds were isolated from 6-week-old C57BL/6 male mice as described below, morphologically selected, and collected into RNAlater (Qiagen). The isolated taste buds were then spun down at 3,600 rpm for 5 min before total RNA was extracted using RNeasy micro kits (Qiagen, Valencia, CA) and treated with RNase-free DNase I to avoid genomic DNA contamination according to the manufacturer's protocol. Similarly, RNA was extracted from lingual epithelial sheets devoid of taste buds that were cut out of the tongue epithelium obtained as described below and collected into RNAlater. First-strand cDNA was synthesized using Superscript III First-Strand Synthesis System for RT (Invitrogen). Taqman gene expression assay was performed with THUNDERBIRD Probe qPCR Mix (TOYOBO, Osaka, Japan) on a real-time PCR system (StepOnePlus, Applied Biosystems). Each sample was obtained from one mouse and each assay was run in triplicate. Expression levels were normalized to that of Calhm2 in taste buds after 2^-ΔΔCt calculation, with β-actin as the endogenous control. The following Taqman assays were used: Calhm1 (Mm01207259_m1); Calhm2 (Mm00505271_m1); Actb (Mm01205647_g1); Calhm3 (5′ AGGCAGTGTCTCGGTACCT 3′ (F), 5′ CACCACTATCACCAGCAAGGTTAT 3′ (R) and 5′ CCAGCCGATGGCCTGT 3′ (reporter)). All assays were exon-exon boundary spanning.

Ma Z., Taruno A., Ohmoto M., Jyotaki M., Lim J.C., Miyazaki H., Niisato N., Marunaka Y., Lee R.J., Hoff H., Payne R., Demuro A., Parker I., Mitchell C., Henao-Mejia J., Tanis J.E., Matsumoto I., Tordoff M.G, & Foskett J.K. (2018). CALHM3 is Essential for Rapid Ion Channel-Mediated Purinergic Neurotransmission of GPCR-Mediated Tastes. Neuron, 98(3), 547-561.e10.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!