The largest database of trusted experimental protocols

Yp0847

Manufactured by Immunoway
Sourced in United States

YP0847 is a laboratory equipment designed for general scientific applications. It is a versatile device that can be utilized in various research and analytical settings. The core function of YP0847 is to perform specific tasks related to the handling, processing, or analysis of samples or materials, as required by the research or laboratory protocols.

Automatically generated - may contain errors

3 protocols using yp0847

1

Western Blot Analysis of Liver Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total protein was extracted from the liver tissue and separated by denaturing sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Proteins were then transferred onto polyvinylidene difluoride membranes (MilliporeSigma, Burlington, MA, USA). The membranes were blocked with 5% milk for 1 h and incubated overnight at 4 °C with primary antibodies against TLR4 (Proteintech Group, Rosemont, IL, USA; 19811-1-AP), MyD88 (Proteintech Group, 23230-1-AP), NF-κB p65 (Immunoway, Plano, TX, USA; YM3111), phospho-NF-κB p65 (Immunoway, YP0847), and β-actin (Immunoway, YM3028). The membranes were washed three times with phosphate-buffered saline with Tween-20 and incubated with secondary antibodies for an hour. Goat anti-rabbit IgG-HRP (Immunoway, RS0002) and goat anti-mouse IgG-HRP (Immunoway, RS0001) were used as secondary antibodies. Dilutions for primary antibodies and secondary antibodies were 1:1000 and 1:10,000, respectively. Band intensities were quantified using the Image J software (version 1.52) and normalized to β-actin levels. Original blots can be found in the accompanying Source Data file.
+ Open protocol
+ Expand
2

Western Blot Analysis of Cellular Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissue or cellular protein was extracted using the RIPA lysis buffer (Beyotime, Shanghai, China), and the cytoplasmic and nuclear fractions were isolated by the extraction kit (P0027, Beyotime, Shanghai, China). The protein quantification was done with the BCA protein assay kit (Thermo Fisher Scientific, USA). The protein extracts were isolated with SDS‐PAGE gel (12%), which were subsequently transferred to the nitrocellulose membranes. The membranes were blocked for 1 h and incubated with following primary STAT3 (1:2000, 60199‐1‐Ig, Proteintech, USA), phospho‐STAT3 (1:1000, YP0250, Immunoway, USA), P65 (1:1000, 66535‐1‐Ig, Proteintech, USA), phospho‐P65 (1:1000, YP0847, Immunoway, USA), IκBα (1:1000, YM3718, Immunoway, USA), β‐catenin (1:1000, #8814, CST, USA), phospho‐β‐Catenin (1:1000, #4176, CST, USA), GSK3β (1: 5000, ab32391, Abcam, USA), Cyclin D1 (1:10000, ab134175, Abcam, USA), LEF‐1 (1:1000, ab131872, Abcam, USA), TCF‐1 (1:1000, #2203, CST, USA) antibodies overnight at 4°C and HRP‐labelled secondary antibodies (1:4000, Sigma, USA) for 2 h at room temperature. The ECL kit (Thermo Fisher Scientific, USA) was utilized to determine the immunoreactive bands, and the band densities were normalized to β‐actin (1:3000, cw0096, CWbiotech, China).
+ Open protocol
+ Expand
3

Circular RNA FISH Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
According to the instructions, the fluorescence in situ hybridization (FISH) analysis was performed by the FISH Kit (F21201, Genepharma, Shanghai, China). Cy3‐labeled mmu_circ_0001109 (5′‐CACGCUGAACACAAUCUUGUUUCCUGGAUGCAGU‐3′) or mmu_circ_0001845 (5′AUUUGCUAGGAACCGGAACAAUCCCCAAAGGGAGC‐3′) probes were also designed and obtained from Shanghai GenePharma (China). After the slides were dewaxed, the probes were added into the hybridization solution and incubated with cells overnight in the dark at 37°C. Subsequently, slides were incubated with the following primary phospho‐STAT3 (1: 200, YP0250, Immunoway, USA), phospho‐P65 (1: 400, YP0847, Immunoway, USA) and β‐catenin (1: 400, #8814, CST, USA) for 2 h at 37°C. Then, slides were incubated with secondary antibody (BS50950, 1: 100, Bioworld, USA). Finally, the slides were counter stained with DAPI and imaged. The fluorescence intensity was calculated by the Image J software.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!