Trizol reagent

Total RNA was prepared from 100–200 mg of endometrial tissue using the TRIzol reagent (Sigma-Aldrich Ireland Ltd., Dublin, Ireland). Tissue samples were homogenized in 3 ml of TRIzol reagent and chloroform, and subsequently precipitated using isopropanol (Sigma-Aldrich Ireland Ltd., Dublin, Ireland). RNA samples were stored at −80°C. Samples of RNA, (20 μg), were purified and treated for contaminating genomic DNA using RNeasy clean-up kits in accordance with manufacturer’s guidelines supplied (QIAGEN, Crawley, West Sussex, UK). This protocol included an on-column DNase treatment step. RNA quality and quantity were assessed using automated capillary gel electrophoresis on a Bioanalyzer 2100 with RNA 6000 Nano Lab-chips according to manufacturer’s instructions (Agilent Technologies Ireland, Dublin, Ireland). Absorbance ratios (28S/18S) and RNA integrity values recorded for all RNA samples extracted post clean-up ranged between 1.8 and 2.0, and 7.5 and 9.8, respectively.

Total RNA was prepared from 100 mg of funicular tissue using TRIzol Reagent (Sigma–Aldrich, Dorset, UK). Tissue samples were homogenized in 1 mL of TRIzol Reagent and 300 μL chloroform and subsequently precipitated using 500 μL isopropanol (Sigma Chemical, Wicklow, Ireland). RNA samples were stored at −80 °C. Then, 20 μg of total RNA from each sample was treated with RNase-free DNase (QIAGEN, Crawley, West Sussex, UK) to prevent genomic DNA contamination and purified using the RNeasy Mini Kit in accordance with the manufacturer’s instructions (QIAGEN, Crawley, West Sussex, UK). RNA quality and quantity were assessed using automated capillary gel electrophoresis on a Bioanalyzer 2100 with RNA 6000 Nano Labchips, according to the manufacturer’s instructions (Agilent Technologies Ireland, Dublin, Ireland). Then, 5 μg of RNA from each sample was used for library construction using standard protocols. Paired-end libraries were constructed for control funiculi at 28 DAF (CF28) and the funiculi associated with silique walls covered with aluminum foil after 7 days treatment, namely 28 DAF (SF28). The median insert size was 250 bp. Two biological replicate RNA samples from each funiculus were sequenced using the Illumina HiSeq 2500V4 system. The total number of mate-paired reads for each sample ranged from 8,000,000 to 13,000,000. Read lengths of 125 bp were collected.

A small piece (<0.5 cm) of AT, liver and small intestine (SI) (jejunum) was collected in a 2 ml Eppendorf tube containing 1 ml TRIzol-reagent (Sigma) and homogenized using a TissueLyzer (QIAGEN). Tissues were homogenized and RNA was extracted using TRIzol-reagent (Sigma) following the manufacturer’s protocol. RNA samples were reverse transcribed to cDNA as follows. After RNA quantification, 50–70 ng of each sample was transferred to a 0.2-ml tube and 1 μl of each of oligo(dT) (Qiagen) and 10 mM dNTPs were added, followed by incubation at 65°C for 5 min in a Veriti 96-well thermal cycler (Applied Biosystems) followed by incubation on ice for 2 min. Four (4 (link)) μl of first strand buffer (Thermo Fischer), 1 μl of each of 0.1 M DTT (Thermo Fischer), RNAse out and 0.5 μl of Superscript III (Thermo Fischer) were added to the sample. The sample was incubated for 60 min at 55°C, then 15 min at 70°C. Finally, cDNA was quantified on a Nanodrop 2000 (Thermo Scientific).
For qPCR reactions, 100 ng of cDNA was mixed with 12.5 μl of SYBR Green and 2.5 μl of each primer of the selected genes in a total volume of 25 μl per sample. A Rotor-Gene Q (QIAGEN) was used for real time thermal cycling. All genes were normalized for levels of transcription relative to the housekeeping gene β-actin.

Serum samples from AS patients and healthy controls were collected. Then, total RNA was extracted from serum samples using TRIzol reagent (TRIzol reagent, Sigma-Aldrich, St. Louis, Missouri). Total RNA was precipitated with isopropanol and then dissolved with DEPC-H2 (General Biotech). cDNA was synthesized by M-MLV-reverse transferase using an RT-PCR kit (Promega) according to the kit instructions. qPCR amplification was performed using ABI 7300 real-time PCR system (Applied Biosystems) using 2X Power SYBR-Green PCR Master Mix (Applied Biosystems) according to the kit instructions (Table 1). The relative expression of mRNA was determined by the relative standard curve method (2^−ΔΔCt) using GAPDH as an internal reference.

The isolation of total RNA from RLS₄₀ was carried out using a TRIzol reagent (Sigma-Aldrich, Darmstadt, Germany) according to the manufacturer’s protocol. Tumour pieces from the mice of the control and experimental groups were homogenised. Blood serum was prepared from the whole blood of mice via clot formation at 37 °C for 30 min and at 4 °C overnight, followed by clot discarding and centrifugation (4000 rpm, 4 °C, 20 min). Serum samples were pooled according to groups. Total RNA was extracted from the serum samples, RLS₄₀ cells and homogenates of the tumour tissue immediately using a TRIzol reagent (Sigma-Aldrich, Darmstadt, Germany) according to the manufacturer’s protocol.
RNA concentration was measured via absorbance at 260 and 280 nm using a Bio Mate 3 (Thermo Electron Corporation, Waltham, MA, USA) spectrophotometer and Qubit (Invitrogen, Carlsbad, CA, USA). The total RNA integrity and quantity were checked using Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

TECs were isolated from fresh kidney cortex tissue and meshed on 150-90-45 µm sieves. Tissue was pushed through the top sieve with a plunger and flushed through consecutive sieves with cold PBS. TECs were washed from the 90 µm sieve and frozen in TRIzol Reagent (Sigma-Aldrich, St. Louis, MI, USA).
Total RNA was extracted from kidney or pre-isolated TECs using TRIzol Reagent. cDNA was synthesized using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems, Waltham, MA, USA). Real-time polymerase chain reaction was performed using TaqMan gene expression assays (Applied Biosystems, Waltham, MA, USA) and SYBR green (Bio-Rad Laboratories, Hercules, CA, USA).

Following the manufacturer’s instructions, the total RNA from tissues was extracted through Trizol Reagent (Merk, T9424) and then reverse transcribed into cDNA though the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, K1622). Stepwise, we conducted the polymerase chain reaction (PCR) analysis via the SYBR Green Master Mix (Thermo Fisher Scientific, A25742). All the reactions were repeated for at least 3 times. We designed the primer sequences as follows: GAPDH, Forward: 5′-GGCAAATTCCATGGCACCG -3′ and Reverse: 5′- TCGCCCCACTTGATTTTGGA -3′; ZBTB16, Forward: 5′-GAGATCCTCTTCCACCGCAAT -3′ and Reverse: 5′-CCGCATACAGCAGGTCATC -3′; CD38, Forward: 5′-AGACTGCCAAAGTGTATGGGA -3′ and Reverse: 5′ -GCAAGGTACGGTCTGAGTTCC; SERPINA10, Forward: 5′-TCTTTAAGGGACTCAGAGAGACC -3′ and Reverse: 5′-TGTGAGGCATTGCGAAAATTCA. GAPDH was set as an internal control. The comparative expression level was evaluated by 2-ΔΔCt method.