Peg8000

Manufactured by New England Biolabs

PEG8000 is a polyethylene glycol product with an average molecular weight of 8,000 daltons. It is a water-soluble, nonionic polymer that is commonly used in various laboratory applications.

Automatically generated - may contain errors

Lab products found in correlation

39 protocols using peg8000

Droplet Formation Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Droplet formation assays were performed in droplet formation buffer (50 mM Tris pH 7.0, 150 mM NaCl), in the presence of a final concentration of 10% PEG-8000 (New England Biolabs, B1004), in a total volume of 12 μL. Droplet formation was initiated by the addition of 1 μL of purified protein (in protein storage buffer) to 11 μL of pre-mixed Droplet formation buffer and PEG-8000 on ice (8.6 μL of Droplet formation buffer +2.4 μL 50% PEG-8000). The final protein concentration in the reaction was 8.3 μM. After the addition of purified protein, the reaction was mixed by pipetting, 10 μL was loaded onto a microscope slide (Fisher Scientific, 12-544-2), and droplets were immediately imaged using a fluorescent microscope (Evos FL) at 40 X magnification. Representative images were chosen for Figure 2.
Droplet formation assays were repeated over the course of about 6 months, with each replicate corresponding to the same experiment carried out on different days, using the same preparation of purified protein.

Lee B., Jaberi-Lashkari N, & Calo E. (2022). A unified view of low complexity regions (LCRs) across species. eLife, 11, e77058.

+ Open protocol

+ Expand

Small RNA Library Preparation Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The 150 ng of small RNAs isolated before MyOne C1 capture were lyophilized dry and then T4 PNK mix (2 μL 5× buffer (500 mM Tris HCl pH 6.8, 50 mM MgCl₂, 50 mM DTT), 1 μL T4 PNK (NEB), 1 μL FastAP (Thermo Fisher Scientific), 0.5 μL SUPERaseIn, and 5.5 μL water) was added for 45 min at 37°C. Next, a pre-adenylated-3′linker was ligated by adding 3′Ligation Mix (1 μL of 3 μM L3-Bio_Linker (Flynn et al., 2016 (link)), 1 μL RNA Ligase I (NEB), 1 μL 100 mM DTT, 1 μL 10× RNA Ligase Buffer (NEB) and 6 μL 50% PEG8000 (NEB)) to the T4 PNK reaction and incubating for 4 h at 25°C. Unligated L3-Bio_Linker was digested by adding 2 μL of RecJ (NEB), 1.5 μL 5′ Deadenylase (NEB), 3 μL of 10× NEBuffer 1 (NEB) and incubating the reaction at 37°C for 60 min. Ligated RNA was purified with Zymo columns as described above and lyophilized dry. cDNA synthesis, enrichment of cDNA:RNA hybrids, cDNA elution, cDNA circularization, cDNA cleanup, first-step PCR, PAGE purification, and second-step PCR took place exactly as previously describe (Zarnegar et al., 2016 (link)).

Flynn R.A., Pedram K., Malaker S.A., Batista P.J., Smith B.A., Johnson A.G., George B.M., Majzoub K., Villalta P.W., Carette J.E, & Bertozzi C.R. (2021). Small RNAs are modified with N-glycans and displayed on the surface of living cells. Cell, 184(12), 3109-3124.e22.

+ Open protocol

+ Expand

RNA Pretreatment for Nanopore Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAs for direct cDNA and PCR-cDNA sequencing were treated with T4 Polynucleotide Kinase (NEB, M0201) following the manufacturer's nonradioactive phosphorylation protocol to dephosphorylate 3′ termini, which facilitates efficient 3′ ligation. After reaction clean-up using ZYMO RNA Clean & Concentrator-5 Kit (ZYMO, R1013), 5′ triphosphates were removed enzymatically to minimize the influence of different 5′ end properties on the template-switching activity. To that end, 2 µg RNA were incubated for 30 min at 37°C with 2 µL RNA 5′ pyrophosphohydrolase (NEB, M0356, 5000 U/mL). The reactions were stopped by cleaning up the samples following the ZYMO RNA Clean & Concentrator-5 Kit (ZYMO, R1013) protocol. To prevent artificial polyadenylation and improve 3′ end accuracy of nanopore sequencing, we used a custom 3′ cDNA RT primer. Accordingly, a custom 3′ adapter (5′-rAppCTGTAGGCACCATCAAT-NH2-3′, NEB, S1315S) was ligated to all RNAs, following the protocol described in Mo et al. (2021) (link). Briefly, 100 ng pretreated RNA was mixed with 50 pmol 3′ adapter, 2 µL 10× T4 RNA ligase reaction buffer (NEB, M0242), 10 µL 50% PEG 8000 (NEB, M0242), 1 µL 40 U µL⁻¹ RNase Inhibitor (NEB, M0314), and 1 µL T4 RNA ligase 2 (truncated K227Q, NEB, M0242, 200,000 U/mL) and incubated at 16°C for 14 h. Finally, RNAs were cleaned up using the ZYMO RNA Clean & Concentrator Kit (ZYMO, R1013).

Grünberger F., Jüttner M., Knüppel R., Ferreira-Cerca S, & Grohmann D. (2023). Nanopore-based RNA sequencing deciphers the formation, processing, and modification steps of rRNA intermediates in archaea. RNA, 29(8), 1255-1273.

+ Open protocol

+ Expand

RNA Adapter Ligation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purified RNA (10.7 μl) was mixed with 2 μl of T4 RNA Ligase Reaction buffer (New England Biolabs), 1 μl of 30 μM RA3 adapter oligonucleotide, 4.8 μl of 50% PEG 8000 (New England Biolabs) and 0.5 μl of RiboLock RNase inhibitor (40 U/μl; Thermo Fisher Scientific). After 2 min of incubation at 70°C, the tube was placed on ice and 1 μl of T4 RNA Ligase 2, Truncated (200 U/μl; New England Biolabs) was added. The reaction was performed for 1 h at 25°C.

Malik D., Kobyłecki K., Krawczyk P., Poznański J., Jakielaszek A., Napiórkowska A., Dziembowski A., Tomecki R, & Nowotny M. (2020). Structure and mechanism of CutA, RNA nucleotidyl transferase with an unusual preference for cytosine. Nucleic Acids Research, 48(16), 9387-9405.

+ Open protocol

+ Expand

RNA Adapter Ligation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Of note, 10.7 µL of purified RNA was mixed with 2 µL of T4 RNA Ligase Reaction buffer (New England Biolabs), 1 µL of 30 µM RA3 adapter, 4.8 µL of 50% PEG 8000 (New England Biolabs) and 0.5 µL of RiboLock RNase Inhibitor (40 U/µL; Thermo Fisher Scientific). After 2 min of incubation at 70°C, the tube was placed on ice, and 1 µL of T4 RNA Ligase 2, Truncated (200 U/µL; New England Biolabs) was added. The reaction was carried out for 1 h at 25°C.

Kobyłecki K., Kuchta K., Dziembowski A., Ginalski K, & Tomecki R. (2017). Biochemical and structural bioinformatics studies of fungal CutA nucleotidyltransferases explain their unusual specificity toward CTP and increased tendency for cytidine incorporation at the 3′-terminal positions of synthesized tails. RNA, 23(12), 1902-1926.

+ Open protocol

+ Expand

Biotinylated mRNA Capture and Linker Ligation

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each sample, 5 µl of M-280 streptavidin Dynabead (Thermo Fisher Scientific Scientific) were washed three times with 1x BWT buffer in DNA loBind tubes (Eppendorf) and resuspended in 50 µl of the same buffer. Dynabeads and RNA from the previous step were combined into these tubes and incubated on a tube rotator for 15 min at room temperature to allow binding of the biotinylated mRNA to the streptavidin beads. After incubation, beads were collected using a magnet and the supernatant was discarded. The beads were washed one time with 1x BWT buffer to remove unbound RNA, followed by two washes with H 2 O to remove the 1x BWT buffer. Beads were resuspended in 9.5 µl of linker ligation reaction mixture containing 4 µl of water, 1 µl of 10x T4 RNA ligase 2 (truncated) buffer (New England Biolabs), 3 µl of 50% PEG 8,000 (New England Biolabs), 1 µl of iTP_3'_linker_ApoI (10 µM) and 0.5 µl of ligase (T4 RNA ligase 2, truncated -200 000 U/ml -New England Biolabs) per reaction. Linker ligation was allowed to proceed on a tube rotator for 2.5 h at room temperature.

Leroy E.C., Perry T.N., Renault T.T, & Innis C.A. (2023). Tetracenomycin X sequesters peptidyl-tRNA during translation of QK motifs. Nature chemical biology, 19(9).

+ Open protocol

+ Expand

Ligation and Detection of RNA 3' Ends

Check if the same lab product or an alternative is used in the 5 most similar protocols

The synthetic RNA with a 3′-OH end or a 3′-P end, or 25- to 50-nucleotide RNA from mouse spleen were performed in the experiment. Then, 50 ng RNA, dissolved in 5.5 μl nuclease-free water mixed with 0.5 μl 10 μM 3′ SR adapter (Takara; sequence: 5′-(rApp)-AGATCGGAAGAGCACACGTCT(NH2)-3′) and 2 μl 50% PEG 8000 (New England Biolabs; B1004), was incubated at 70 °C for 2 min. Following this, the sample was immediately incubated on ice for 5 min. Next, 1 μl 10× T4 ligase reaction buffer (New England Biolabs; B0216L) and 1 μl T4 RNA Ligase 2, truncated KQ (New England Biolabs; M0373L) were added to the sample, which was mixed well. After incubation at 25 °C for 1 h and 75 °C for 5 min, the sample was run on 15% (wt/vol) urea polyacrylamide gel, followed by northern blot using the anti-3′ SR adapter probe (Takara; sequence: 5′-(DIG)-AGACGTGTGCTCTTCCGATCT-3′) to detect the ligation outcome of the input RNAs.

Shi J., Zhang Y., Tan D., Zhang X., Yan M., Zhang Y., Franklin R., Shahbazi M., Mackinlay K., Liu S., Kuhle B., James E.R., Zhang L., Qu Y., Zhai Q., Zhao W., Zhao L., Zhou C., Gu W., Murn J., Guo J., Carrell D.T., Wang Y., Chen X., Cairns B.R., Yang X.L., Schimmel P., Zernicka-Goetz M., Cheloufi S., Zhang Y., Zhou T, & Chen Q. (2021). PANDORA-seq expands the repertoire of regulatory small RNAs by overcoming RNA modifications. Nature cell biology, 23(4), 424-436.

+ Open protocol

+ Expand

RNA Ligase Mediated Ligation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The eluate was incubated at 65°C for 2 min and then placed on ice. Other components of the ligation mix were added (total volume: 28 µL): 2.8 µL 10× T4 RNA ligase buffer (NEB), 5.6 µL 50% PEG8000 (NEB), 2.8 µL DMSO (Sigma-Aldrich), 0.7 µL RNase Inhibitor, and 1.4 µL 30 U/µl T4 RNA ligase 1 (NEB). The mix was incubated at 25°C for 2 hours.

Rozenberg A., Leese F., Weiss L.C, & Tollrian R. (2016). Digital gene expression analysis with sample multiplexing and PCR duplicate detection: A straightforward protocol. BioTechniques, 61(1).

+ Open protocol

+ Expand

Small RNA Library Preparation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small RNAs were treated with RNA phosphatase PIR-1 to remove γ and β phosphates from the 5′ triphosphorylated RNAs.^{64 (link)} Monophosphorylated RNAs were ligated to 3’ adapters (rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/, IDT) using T4 RNA ligase 2 in 25% PEG 8000 (NEB) at 15°C overnight. A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C. Ligated products were reverse transcribed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific) to convert RNA to cDNA libraries. cDNA libraries were amplified by PCR and subsequently sequenced on an Illumina Novaseq platform (SP2 x 50 bp) at the OSU Comprehensive Cancer Center genomics core.

Pastore B., Hertz H.L, & Tang W. (2024). Pre-piRNA trimming safeguards piRNAs against erroneous targeting by RNA-dependent RNA polymerase. Cell reports, 43(2), 113692.

+ Open protocol

+ Expand

Small RNA Sequencing of Mutants

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Small RNA samples from wild-type and mutants were pretreated with a recombinant 5′ polyphosphatase PIR-1 that removes the γ and β phosphates from 5′-triphosphorylated RNA (Li et al., 2020 (link)). The resulting monophosphorylated small RNAs were ligated to a 3′ adaptor (5′rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3′, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15°C overnight. The 5′ adaptor (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to the product using T4 RNA ligase 1 (NEB) at 15°C for 4 h. The ligated products were converted to cDNA using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). The cDNAs were amplified by PCR, and the libraries were sequenced on an Illumina Novaseq platform (SP 2 X 50 bp) at the OSU Comprehensive Cancer Center genomics core.

Pastore B., Hertz H.L., Price I.F, & Tang W. (2021). pre-piRNA trimming and 2′-O-methylation protect piRNAs from 3′ tailing and degradation in C. elegans. Cell reports, 36(9), 109640.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!