Log In Sign up
The largest database of trusted experimental protocols

Cdna synthesis kit

Manufactured by Biofact
Visit Supplier
Sourced in Cameroon

The cDNA Synthesis Kit is a laboratory tool used to convert RNA into complementary DNA (cDNA) molecules. The kit provides the necessary reagents and protocols to perform this reverse transcription process, which is a fundamental step in various molecular biology and genomics applications.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop spectrophotometer, by Thermo Fisher Scientific (4 mentions) Riboex reagent, by GeneAll (3 mentions) Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (2 mentions) Abi prism 7900ht, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Trizol reagent, by GeneAll (2 mentions) Sybr green, by Biofact (2 mentions) Abi steponeplus thermal cycler, by Thermo Fisher Scientific (2 mentions) Total rna prep kit, by Biofact (2 mentions) Sybr green qpcr master mix, by Biofact (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) Rnaiso plus reagent, by Takara Bio (1 mentions) Rotor gene q, by Qiagen (1 mentions) Sybr green master mix, by Qiagen (1 mentions) Sybr green master mix, by Biofact (1 mentions) Miscript 2 rt kit, by Qiagen (1 mentions) Lightcycler 96, by Roche (1 mentions) Riboex, by GeneAll (1 mentions) Relative expression software tool, by Qiagen (1 mentions) Corbett rotor gene 6000, by Qiagen (1 mentions)

31 protocols using cdna synthesis kit

1

Evaluating ER Stress Response Markers in Liver Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols
According to the manufacturer’s protocol, the total RNA was extracted from the liver using RNAiso Plus reagent (TaKaRa Biotechnology, Dalian, Liaoning, China) and stored at −75°C. We used BioFact cDNA synthesis kit (Biofact, Daejeon, Korea) to synthesize cDNA. Table 2 provides specific primer sets for target genes. The expression levels of GRP78, PERK, ATF6α, CHOP, and XBP1 were performed by applying SYBR Green Master Mix on a RotorGene Q real-time PCR machine (Qiagen, Hamburg, Germany). In short, a total volume of 20 μl in a 0.2-ml test tube was run at 95°C for 30s, and then, 40 cycles were performed at 95°C for 20s and 60°C for 40 s. Each experiment was repeated 3 times. The expression levels of GRP78, PERK, ATF6α, CHOP, and XBP1 were standardized to the GAPDH genes as housekeeping genes by applying the 2-ΔΔCt method.

The sequence of primer sets applied for real-time PCR assays

GenePrimersTMProduct
Heat shock protein 5 (Hspa5/GRP78)

F- CCAGCGACAAGCAACCAAAG

R- AGCTGCTGTACTGTGAGGATG

59.8174 bp
Activating transcription factor 6 (ATF6α)

F-GATGCCTTGGGAGTCAGACC

R-ATGGAGCAACTGGAGGAAGC

60163 bp
Eukaryotic translation initiation factor 2 alpha kinase 3 (Eif2ak3/Perk)

F- AGAGATAGATGGGTGGCAAAA

R: ATTCGTCCATCTAAAGTGCTG

56157 bp
X-box binding protein 1 (XBP1)

F- GGAGCAGCAAGTGGTGGATT

R- ATCCAGCGTGTCCATTCCC

60136bp
CHOP

F- CTGGAAGCCTGGTATGAGGAT

R- CAGGGTCAAGAGTAGTGAAGGT

59.5185 bp
Totonchi H., Mokarram P., Karima S., Rezaei R., Dastghaib S., Koohpeyma F., Noori S, & Azarpira N. (2022). Resveratrol promotes liver cell survival in mice liver-induced ischemia-reperfusion through unfolded protein response: a possible approach in liver transplantation. BMC Pharmacology & Toxicology, 23, 74.
+ Open protocol
+ Expand
2

Quantifying BACH1 mRNA and miR-330 in CRC

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to evaluate the BACH1 mRNA and miR-330 level, total RNA was purified from CRC cells using RiboEX reagent (GeneAll, GeneAll biotechnology, Seoul, Korea). In order to cDNA synthesis for BACH1, BioFact cDNA synthesis kit was used for the synthesis of 1 µg of total RNA (Daejeon, Korea) via Boi-Rad thermal cycler instrument (Hercules, CA) according to manufacturer’s instruction. The reactions for qRT-PCR assays contained 5 µL of 2X SYBR green master mix (Biofact, Daejeon, Korea), 0.25 µL of specific primer (Table 1), 0.5 µL of cDNA, and 4.25 µL of distilled water. The mixture amplified using LightCycler 96 instrument (Roche Diagnostics, Mannheim, Germany).
The miScript II RT Kit (Qiagen) was used to synthesize cDNA for the miRNA evaluation. The qRT-PCR for miR-330 were performed by Exiqon SYBR green master mix and specific primers (Table 1) for studying the microRNA expression. Beta-actin and U6 were used as internal control for BACH1 and miR-330, respectively.
Shirjang S., Mansoori B., Mohammadi A., Shajari N., H.G. Duijf P., Najafi S., Abedi Gaballu F., Nofouzi K, & Baradaran B. (2020). miR-330 Regulates Colorectal Cancer Oncogenesis by Targeting BACH1. Advanced Pharmaceutical Bulletin, 10(3), 444-451.
+ Open protocol
+ Expand
3

PBMC Extraction and RNA Isolation

Check if the same lab product or an alternative is used in the 5 most similar protocols
PBMC extraction was performed using Lymphodex, Inno-Train, Germany extraction kit. The RNA was extracted using RiboEx, GeneAll (Cat. No. 301-902). After RNA extraction, cDNA was synthesized by BioFact cDNA synthesis kit (Cat. No. BR441-096).
Firoozi Z., Mohammadisoleimani E., Bagheri F., Taheri A., Pezeshki B., Naghizadeh M.M., Daraei A., Karimi J., Gholampour Y., Mansoori Y, & Montaseri Z. (2024). Evaluation of the Expression of Infection-Related Long Noncoding RNAs among COVID-19 Patients: A Case-Control Study. Genetics Research, 2024, 3391054.
+ Open protocol
+ Expand
4

RNA Extraction and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols
YTA RNA Extraction Kit (YEKTA TAJHIZ AZMA, Taiwan) was used to extract total RNA from peripheral blood samples. The concentration and purity of the extracted RNA were determined using NanoDrop spectrophotometry (optical density =260/280) and samples were stored at -80°C until the next use. Complementary DNA (cDNA) synthesis was done by the Biofact cDNA Synthesis Kit (2 steps 2x RT-PCR Pre-mix Taq, Korea).
Nafari M., Asri N., Rostami-Nejad M., Forouzesh F., Ehsani-Ardakani M.J., Jahani-Sherafat S., Rezaei-Tavirani M, & Aghdaei H.A. (2022). Elevated interleukin-17A levels despite reduced microRNA-326 gene expression in celiac disease patients under gluten-free diet. Romanian journal of internal medicine = Revue roumaine de medecine interne, 60(3).
+ Open protocol
+ Expand
5

Quantifying Expression of Cell Proliferation and Apoptosis Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Based on results of MTT assay, after treating the test cells with the combination of 20 nM EE and 90 nM LNG, and control cells with the normal medium for 48h, the total RNA was isolated using RNeasy Mini, RNA isolation kit (Qiagen, Germany) according to manufacturer’s instructions. RNA concentration was measured by Nanodrop 2000c spectrophotometer (Thermo Scientific, USA), and cDNA were synthesized by cDNA Synthesis Kit (Bio FACT, Daejeon, South Korea). The changes in mRNA expression of MKI67, BAX, Bcl2 genes and Beta-2-microglobulin (β2M), as internal control, were estimated by quantitative reverse transcriptase PCR (qRT-PCR) in a rotor gene 6000 Corbett (Corbett Research, Sydney, Australia) detection system SYBR GREEN® (nonspecific DNA-binding factors). The primer sequences are provided in Table-1. Alterations of gene expression of KI67, BAX, and Bcl2 compared with β2M were normalized by LinReg software (Linreg version 2012.1, Amsterdam, the Netherlands). Expression levels of the mentioned gens were quantified by REST program (Relative Expression Software Tool, Qiagen, Germany).
Hedayati M., Rajabi S, & Nikzamir A. (2020). Papillary Thyroid Cancer-Promoting Activities of Combined Oral Contraceptive Components. Galen Medical Journal, 9, e1648.
+ Open protocol
+ Expand
6

Betanin Modulation of STZ-Induced Diabetes

Check if the same lab product or an alternative is used in the 5 most similar protocols
STZ was purchased from Sigma Aldrich (Germany) and betanin was purchased from TCI (Japan). Rat insulin kit (ELISA) was provided from Bioassay Technology Laboratory (BT Lab), Shanghai Korain Biotech Co Ltd (China). The kits used for measuring aspartate aminotransferase (AST), alanine aminotransferase (ALT), triglyceride (TG), total cholesterol (TC), and high-density lipoprotein cholesterol (HDL-C) were obtained from Pars Azmoon, Iran. Ethanol, methanol, eosin, hematoxylin, and paraffin were purchased from MERCK (Germany). The total RNA isolation kit was provided from FAVORGEN (Taiwan). The cDNA synthesis kit was obtained from BioFACT (Korea) and SYBR Green Master Mix from TaKaRa (Japan).
betanin was purchased from TCI America (CAS Number: 7659-95-2, Product number: B0397, Lot number: 25XUG).
Abedimanesh N., Asghari S., Mohammadnejad K., Daneshvar Z., Rahmani S., Shokoohi S., Farzaneh A.H., Hosseini S.H., Jafari Anarkooli I., Noubarani M., Andalib S., Eskandari M.R, & Motlagh B. (2021). The anti-diabetic effects of betanin in streptozotocin-induced diabetic rats through modulating AMPK/SIRT1/NF-κB signaling pathway. Nutrition & Metabolism, 18, 92.
+ Open protocol
+ Expand
7

Quantitative Gene Expression Analysis in Injured Spinal Cord

Check if the same lab product or an alternative is used in the 5 most similar protocols
Injured spinal cord segments of the control and treatment groups were isolated at 1, 4, 7, and 28 days after injury. The total RNA was extracted from the homogenized spinal cord tissue with TRIzol reagent (bio basic) according to the manufacturer’s instructions. The RNA concentration in each sample was measured using NanoDrop (Thermo Fisher Scientific, Waltham, MA, USA). Then, 1 μg of purified RNA was reverse-transcripted into First-strand cDNA using a cDNA Synthesis Kit (biofact, South Korea). To measure gene expression, quantitative PCR was performed using a cyber green PCR master mix with a high ROX (biofact) on a StepOnePlus Real-Tim PCR Applied Biosystem. Real-time PCR was conducted in triplicate with each RNA sample. The program was as follows, 95°C for 15 min. followed by 45 cycles of 15 s at 94, 60°C for 15 s, and 72°C for 30 s in sequence. The forward and reverse primers used for RT-qPCR were designed using the online software NCBI/Primer-BLAST listed in Table 1. GAPDH was used as an internal control. The relative expression level of the target gene was analyzed using a 2–ΔΔCt) method. A primer sequence was used for qPCR.
Hashemizadeh S., Hosseindoost S., Omidi A., Aminianfar H., Ebrahimi-Barough S., Ai J., Arjmand B, & Hadjighassem M. (2022). Novel therapeutic approach to slow down the inflammatory cascade in acute/subacute spinal cord injury: Early immune therapy with lipopolysaccharide enhanced neuroprotective effect of combinational therapy of granulocyte colony-stimulating factor and bone-marrow mesenchymal stem cell in spinal cord injury. Frontiers in Cellular Neuroscience, 16, 993019.
+ Open protocol
+ Expand
8

Quantifying Gene Expression Using qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Twenty-four hours after treatments, the total RNA extraction was performed using RiboEx LS RNA (GeneAll Biotech, Seoul, Korea). Then, the cDNA of samples was obtained from RNAs using the cDNA synthesis kit (BioFact, Daejeon, Korea) to measure the expression of target mRNAs. Then, the qRT-PCR was performed with a standard SYBR Green PCR master mix (BioFact, Daejeon, Korea) protocol in the StepOnePlus real-time PCR. The GAPDH gene was used as a reference gene for SOX-2, CD44, ROCK1, MMP9, caspase-9, -8, -3, and Bcl-2 genes. The primer sequences used in this study are shown in Table 3. The relative expression levels of target genes were normalized to internal controls using the 2−ΔΔCt cycle threshold method.
Gholizadeh M., Doustvandi M.A., Mohammadnejad F., Shadbad M.A., Tajalli H., Brunetti O., Argentiero A., Silvestris N, & Baradaran B. (2021). Photodynamic Therapy with Zinc Phthalocyanine Inhibits the Stemness and Development of Colorectal Cancer: Time to Overcome the Challenging Barriers?. Molecules, 26(22), 6877.
+ Open protocol
+ Expand
9

Quantitative Assessment of Nrf2, PD-L1, and CD80 Expressions

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted via RiboEx reagent (GeneAll, Korea) according to the manufacturer’s protocol. The total RNA of clinical tissue was extracted via grinding them in 1 ml RiboEx reagent using porcelain glass grinder. Complete DNA (cDNA) was synthesized from 1 μg of total RNA using cDNA synthesis kit (Biofact, Korea). Then, qRT-PCR technique was applied to assess gene expressions. First, total RNA of tumor tissues and cells were extracted using the RiboEx reagent (GeneAll, Korea) according to the manufacturer’s protocol. Then, total RNA was quantified and qualified by NanoDrop Spectrophotometer (Thermo Fisher Scientific, USA) and agarose gel electrophoresis, respectively. Thereafter, cDNA was synthesized by a cDNA synthesis kit (Takara, Japan). Finally, mRNA expressions were examined by the Roche LightCycler system (Roche, Germany) by applying SYBR Premix Ex Taq (Takara, Japan). Relative Nrf2, PD-L1, and CD80 mRNA expressions in tissue samples were analyzed through the 2–ΔΔCt method, in which endogenous β actin was considered as an internal control. However, for the assessment of raw data from the cell samples, Pffafl method was applied and GAPDH gene was considered as an internal control. All of the experiments were performed at least in triplicate.
Payandeh Z., Pirpour Tazehkand A., Mansoori B., Khaze V., Asadi M., Baradaran B, & Samadi N. (2021). The Impact of Nrf2 Silencing on Nrf2-PD-L1 Axis to Overcome Oxaliplatin Resistance and Migration in Colon Cancer Cells. Avicenna Journal of Medical Biotechnology, 13(3), 116-122.
+ Open protocol
+ Expand
10

Rutin's Effect on Breast Cancer Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
The effect of rutin on the gene markers of proliferation, EMT, and angiogenesis was evaluated by using the Quantitative Real-time PCR technique. Following the treatment of MDA-MB-231 and MCF-7 cell lines with rutin at the concentration of 200 µM for 48 h, the total RNAs were extracted from treated and control cells by an RNeasy mini kit (Qiagen Co., Seoul, Republic of Korea). To assess the quality of total RNA, the absorbance of the samples was measured by a Nanodrop 2000c spectrophotometer. Afterward, 2 μg of total RNA sample was collected to synthesize cDNA molecules using a cDNA Synthesis Kit (BioFact, Daejeon, Republic of Korea). Then, ABI PRISM7900HT (Applied Biosystems, Carlsbad, CA, USA) qRT-PCR detection system with SYBR GREEN PCR master mix (Ampliqon, Copenhagen, Denmark) was used to assess the expression levels of MKI67, CDH1, CDH2, VIM, FN1, VEGFA, and THBS1 genes. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene expression was considered the internal control gene. Relative expression (fold changes) of the above-mentioned genes was calculated using the 2−ΔΔCT formula. Table 1 shows the primer sequences used for the amplification of the the genes.
Hajimehdipoor H., Tahmasvand Z., Nejad F.G., Maresca M, & Rajabi S. (2023). Rutin Promotes Proliferation and Orchestrates Epithelial–Mesenchymal Transition and Angiogenesis in MCF-7 and MDA-MB-231 Breast Cancer Cells. Nutrients, 15(13), 2884.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!