Dnase

Frataxin mRNA expression in tissues was compared by qRT-PCR. The RNA was first extracted by adding 1 mL of Trizol to the finely crushed tissue slice. A total of 200 µL chloroform was then added to separate the phases during 15 min centrifugation at 12,000 rpm. The supernatant was collected and precipitated in 500 µL cold (−20 °C) isopropanol centrifuged at 12,000 rpm for 10 min. The liquid was then removed from the tube to keep only the pellet to be washed twice with 1 mL 75% cold (−20 °C) ethanol and centrifuged at 10,000 rpm for 5 min. The pellet was resuspended in 20–60 µL RNAse free water. The RNA concentration was measured with a spectrophotometer and the migration on agarose gel 1% permitted to verify that the RNA was not degraded. The sample was then treated with DNAse (NEB Inc.) incubated for 10 min at 37 °C, then the DNAse was deactivated with EDTA 2.5 mM at 75 °C for 10 min. The RNA was then put in the presence of Reverse Transcriptase with dNTPs and random primers in the buffer provided by Thermo Fischer Scientific Inc. (Waltham, MA, USA) in the ‘High Capacity cDNA Reverse Transcription kit’. A qPCR was then performed with the complementary DNA obtained. This qRT-PCR used primers for frataxin as well as for HPRT, a reference gene (Supplementary Table S1).

To stain cells using fluorescence-activated cell sorting antibodies for analysis or sorting, cells were first dissociated into single cells. To obtain single cells from organoids, cell pellets were incubated in 2 ml of Trypsin-Versene (Lonza) for 2 min at 37 °C, mechanically dissociated with rapid pipetting, then incubated with 1 μg/ml DNase (New England BioLabs, Ipswich, MA, USA) for 5 min at 37 °C. Cells were washed with complete media and spun at 1500 rpm for 5 min, then strained through a 0.45-μm cell strainer to obtain single cells. Cells were washed with 1× PBS and resuspended in 400 μl of sorting buffer (2.5% FBS in PBS). To stain cells, 3 μl of each directly labelled antibody was added per 10 million cells and incubated on ice for 1 h, washed with sorting buffer, resuspended in sorting buffer, and sorted using a BD FACSAria cell sorter (BD Biosciences). Antibodies used for sorting experiments were as follows: epithelial cell adhesion molecule (EpCAM)-allophycocyanin (APC) (175791; eBioscience, San Diego, CA, USA), CD24-APC (170242; eBioscience), β1-integrin-eFluor 450 (48-0291; eBioscience), and α6-integrin-eFluor 450 ( 48-0495; eBioscience).

Western ligand affinity blotting was performed as previously described [4 (link)], with modifications. Briefly, overnight cultures were diluted 1:50 in TSB medium and grown at 37°C with shaking for 4 hours. Cells were washed and surface-associated protein extracts were prepared through resuspension in PBS media containing 20 μg/mL lysostaphin (Sigma), 20 μg/mL DNAse (New England Biolabs), 1 mM phenylmethanesulfonylfluoride (PMSF, Thermo Scientific), and 1:100 dilution of a protease inhibitor cocktail (Sigma, P2714). Cell extracts were incubated at 37°C for 30 minutes and spun at 12,000 x g for 1 minute at 4°C. The protein concentration in the supernatant was determined with a BCA Protein Assay Kit (Pierce), and 20 μg of each sample was separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). FnBPs were detected by incubation for 1 hour with biotinylated human fibronectin (50 μg/mL) in PBS containing 0.1% Tween 20 (PBST). An EZ-Link sulfo-N-hydroxysuccinimide-LC biotinylation kit (Pierce) was used to biotinylate human fibronectin (Sigma). After washing with PBST, membranes were incubated for 1 hour with streptavidin-peroxidase conjugate (Roche; 1:3000 dilution). Finally, membranes were developed with the ECL Western blotting system (Pierce). A S. aureus fnbA fnbB double mutant [19 (link)] was used as a negative control.

Total RNA samples were extracted using TRIzol. All samples were treated with DNase (NEB) for 30 min at 37 °C to remove any DNA contamination. DNase was inactivated by addition of 25 mmol/l EDTA and incubation at 65 °C for 15 min. cDNA was produced by using miScript II RT Kit (Qiagen, Hilden, Germany) per manufacturer’s instructions. cDNA samples were diluted 1:2 before qPCR. The qRT-PCR was carried out using miScript SYBR Green PCR kit (Qiagen) per manufactures protocol. Either Qiagen designed primers compatible with miScript kit were purchased to quantify conserved microRNAs, and custom designed primers were made by IDT to amplify axolotl mRNAs. Custom axolotl primers used:
18S_F:
CGGCTTAATTTGACTCAACACG
18S_R:
TTAGCATGCCAGAGTCTCGTTC
Sall4_F:
AATCCCTCGCAAGCCC
Sall4_R:
CCAGCTATGAGGGGAACATT
Collagen I_F:
TCCCAAAACATCACCTACCAC
Collagen I_R:
AGCTCTGATCTCAATCTCGTTG
Collagen XII_F:
TCAGCGTGAATTCTGTGTAGG
Collagen XII_R:
CTTCGACGTGTCTCCTGAAAG

RNA was isolated from 6 hr culture of B. pseudomallei grown at 37°C by adding 10 ml of RNAprotect bacterial reagent (QIAGEN) to 5 ml of bacteria culture and incubating for 5 min at room temperature. Subsequently, total RNA was extracted from bacterial pellets using Trizol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions and treated with DNase (NEB, MA, USA) for 10 min at 37°C before use. Conventional PCR for 23S RNA gene was used to verify that there was no gDNA contamination in the DNase‐treated RNA samples. Real‐time RT‐PCR was performed for six genes (rpoE, groEL, htpG bopA, bopE, and bipD) using Brilliant II SYBR^® Green QPCR Master Mix, one step (Agilent Technologies, Santa Clara, CA, USA) with following conditions: reverse transcription at 50°C for 30 min, enzyme activation at 95°C for 10 min, then 40 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 1 min, and melting curve analysis at 72°C for 1 min in a CFX96 Touch^™ Real‐Time PCR Detection System (CA, USA). Real‐time RT‐PCR primers are listed in Table 1. Relative mRNA levels were determined by fold change in expression, calculated by 2^−ΔΔCT using the relative mRNA level of 23S RNA, representing a house‐keeping gene expression, as a baseline for comparison.